PLANT BREEDING NEWS
EDITION 222
31 March 2011
An Electronic Newsletter of Applied
Plant Breeding
Clair H. Hershey, Editor
Sponsored by GIPB, FAO/AGP and
Cornell UniversityÕs Department of Plant Breeding and
Genetics
-To
subscribe, see instructions here
-Archived
issues available at: FAO Plant Breeding Newsletter
1. NEWS,
ANNOUNCEMENTS AND RESEARCH NOTES
1.01 FAO Director-General
urges increase in agricultural investments
1.02 Trio of factors pushing food prices higher, economist says
1.03 A Hybrid Path to Feeding 9 Billion on a Still-Green Planet
1.04 Forty
Findings on the Impacts of CGIAR Research 1971–2011
1.05 Bioenergy crops could lower surface temperatures,
Stanford University researchers say
1.06 About
the National Association of Plant Breeding (USA)
1.07 One-pager on plant
breeding from the National Association of Plant Breeders (USA)
1.08 Plant Breeding Academy training has a big impact on
career development
1.09 University of Missouri researcher leads new $6.6
million study that could lead to better corn plants
1.10 Iowa State UniversityÕs new plant breeding masterÕs
degree to serve career professionals remotely
1.11 Cucurbit breeding activities in Southeast Asia
capture attention of seed company representatives
1.12 Pearl millet set for release in India next year
1.13 New rice variety could ease MozambiqueÕs grain
supply
1.14 PHILRICE Recommends better rice varieties for irrigated
lowland
1.15 Hands-on training for ÒRice Seed ProductionÓ
1.16 Why enhanced cooperation on patent protection is a
step towards enhanced innovation
1.17 FAO seed treaty carries hope, addressing country
contributions, farmers concerns
1.18 Plant breeders say they have got a new weapon in the
war against the illegal use of seeds
1.19 Two Cents: The GMO Debate
1.20 Mexico oks pilot field of genetically modified
corn
1.21 Details
of EU proposals on GM crops
1.22 Long week ahead for WIPO experts considering treaty
on IP and genetic resources
1.23 UN-backed treaty meeting seeks to boost conservation
of worldÕs plant varieties
1.24 Rebuild small seed enterprises - Farmers' seed
ventures key to food security in developing countries
1.25 Genebanks could be storing the wrong seeds - Dutch
study investigates the authenticity of heirloom cultivars stored at genebanks
1.26 Agriculture ministers and senior officials from more
than 100 countries commit to review the world crop gene pool
1.27 Study shows how plants sort and eliminate genes over
millennia
1.28 U.S. dairy farmer finds unusual forage grass
1.30 Genebanks could be storing the wrong seeds
1.31 'Tequila' plants as biofuel crops
1.32 Scientists study diversity between and within
farmersÕ tomato varieites from Eritrea
1.33 Flood-tolerant rice plants can also survive drought,
say UC Riverside scientists
1.34 Improving rice yield in salty soils
1.35 Molecular marker screening of tomato germplasm for
root-knot nematodes resistance
1.36 United Kingdom -
BASF launches new canopy assessment tool app for iPhone
1.37 Research finds path to corn smut resistance
1.38 Nuevos resultados genŽticos sobre la calidad del
trigo
1.39 Key plant traits yield
more sugar for biofuels
1.40 Promising results for breeding drought-resistant
cowpea
1.41 Two genes better than one for important plant pest
1.42 Evaluation of the brown planthopper resistance genes
in hybrid rice
1.43 Global wheat rust project gets US$40 M support
1.44 Release of insect resistant maize hybrids
1.45 Cient’ficos espa–oles logran plantas resistentes a
diferentes virus inhibiendo un œnico gen
1.46 DNA markers for marker-assisted breeding: a brief
overview
1.47 Cloned seeds show promise for crop breeding
1.48 Arabidopsis anticipates mildew attack in the morning
1.49 Phytochemicals of Brassicaceae in plant protection
and human health – Influences of climate, environment and agronomic
practice
1.50 How do plants fight disease?
2.01 New book: ÔBreeding crops with resistance to
diseases and pestsÕ
2.02 FAO
policy guide: Promoting the Growth and Development of Smallholder Seed
Entrprises for Food Security Crops
2.03 New publication on
the origin of and centers of diversity of maize in Mexico
3. WEB AND NETWORKING RESOURCES
3.01 Information on seeds from FAO
4.01 Wanted: global rice science scholars
4.02 OWSDW
Prizes 2011 for young women scientists in developing countries (second call)
4.03 TWAS South-South Fellowships Programme
4.04 Awards nominations requested from the National Association of Plant
Breeders (NAPB)
5.01 Job Description: Hot Pepper Breeder (Vegetables Division)-002ED
6. MEETINGS, COURSES AND WORKSHOPS
7. EDITOR'S NOTES
1 NEWS, ANNOUNCEMENTS AND RESEARCH NOTES
1.01 FAO Director-General urges increase in agricultural
investments
Abu Dhabi, United Arab Emirates
15 March 2011
FAO Director-General Jacques Diouf today
reiterated his call for greater investment in agriculture, using the example of
the United Arab Emirates (UAE) investments in date palm development, a program
that has made it the seventh date producer in the world, with 6 percent of
global date production.
The Director-General's comments came at the
opening of the third edition of the Khalifa International Date Palm Award,
which today awarded prizes to eight winners for excellence in research,
techniques, production, cultivation and development. The award is designed to
raise awareness of the role of dates in food security.
Date palm trees a UAE cultural heritage
"This initiative truly reflects the
importance of the date palm in the cultural heritage of the United Arab
Emirates and in the food economy of the region", Diouf said, explaining
that the sector constitutes a priority for economic diversification in the
government's development plan.
"However, there is a need to increase
the supply of quality plant material for local and regional needs and to go
beyond the present framework of date production by Government plantations and a
limited number of private farmers," he added.
Diouf paid tribute to Sheikh Khalifa Bin
Zayed Al Nahyan, saying that the UAE president's commitment to the development
of agriculture and, specifically, to the date palm had prompted increased
investment in agriculture and a greater use of modern technology.
"It was thus possible to obtain an
increase in the number of date palms, a multiplication of varieties, and a
marked improvement in the marketing and processing of dates", Diouf said.
But investment in agriculture still lagging
But the Director-General reminded his
audience that, as in 2008, international agricultural markets again face higher
food commodity prices that could undermine food security in a world where
population, and thus the demand for food, are sharply on the rise.
The expected growth in population - from
6.9 billion people today to 9.1 billion in 2050 - will require a 70 percent
increase in global food production and a 100 percent increase the developing
countries, he said adding that investment was not keeping pace.
"The share of agriculture in official
development assistance fell from 19 percent in 1980 to 3 percent in 2006.
Currently, it stands at 5 percent. Developing countries only allocate 5 percent
of their national budgets to the sector, instead of 10 percent, despite its
contribution to gross domestic product, exports and the balance of
payments", Diouf said.
Meanwhile, more than 100 million tonnes of
cereals are diverted from food to biofuels on account of subsidies valued at 13
billion US dollars and tariff protection of the developed countries.
"If we add the impact of droughts,
floods, hurricanes and other events exacerbated by climate change and the
speculation on agricultural commodity futures markets, it becomes clear that
the current situation is the chronicle of a disaster foretold," he added.
The DG commended the UAE for attaching
great importance to the agricultural sector despite the country's land and
water constraints and thereby pursuing the policy of the UAE's
"visionary" leader, the late Sheikh Zayed, who declared "Give me
agriculture and I will give you civilization".
http://www.seedquest.com/news.php?type=news&id_article=15398&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
++++++++++++++++++++++
1.02 Trio of factors
pushing food prices higher, economist says
West Lafayette, Indiana, USA
March 11, 2011
Grain shortages, Middle East turmoil and
extreme weather in critical crop-producing regions have combined to send retail
food prices higher this year, said a Purdue University agricultural economist.
Prices could climb further if commodities markets continue their upward march.
American consumers can expect to spend
about 4 percent more for food this year than in 2010, said Corinne Alexander.
Beef, pork and poultry products likely will see even greater price hikes, she
said.
U.S. food price inflation reached 7.5
percent in September 2008 before falling 10.5 percent by November 2009. It's
been moving back up ever since.
"We're returning to a period of food
price inflation after coming off a period where we saw food price
deflation," Alexander said. "We don't expect this to be a long-term,
permanent higher food price period. We'll see these higher food prices until we
rebuild global stocks of the primary crops."
Shortages in corn, soybean and wheat stocks
have pushed prices to their highest levels this decade. Corn and soybeans are
used for food products, animal feed and in biofuels production, while wheat is
the principal ingredient in breads and cereals.
Since mid-2010, corn futures prices have
more than doubled to more than $7 per bushel and could exceed the $7.65 record
set in 2008. Soybean prices are up 40 percent from one year ago, to just over
$13 a bushel. Wheat futures have risen more than 50 percent since this past
July, to $7.75 per bushel.
"With higher grain costs, the biggest
food inflation price impacts we expect to see are in the livestock area,"
Alexander said. "Because those feed costs are up, we're expecting beef
prices to be up on the order of 5.5 to 6.5 percent in the coming year. Pork
prices will be up on the order of 7 to 8 percent. Poultry prices will rise more
moderately because it doesn't take near as much grain to get a pound of chicken
as it does a pound of pork or beef, so chicken prices will be up about 3 to 4
percent."
Oil markets also are affecting food prices.
Recent uprisings in Egypt and Libya have sent oil soaring to more than $100 a
barrel. Food companies have absorbed some of those price shocks but will have
to charge more for their products should oil markets surge higher, Alexander
said.
"We're in a world today where food companies
operate on the assumption that crude oil prices are going to be $85 to $95 a
barrel," she said. "Current prices are somewhere around $105 to $110
a barrel."
Weather has played havoc with food
production, as well. Drought devastated Russia's 2010 wheat crop, leading
Moscow to ban wheat exports. Freezing temperatures this winter cut into
Mexico's production of tomatoes and bell peppers.
Storms have battered the sugar industry,
sending prices to more than double what they were in 2009.
"Brazil didn't have a great
crop," Alexander said. "Add on top of that Australia, the third
largest exporter of sugar in the world. Queensland, which is their
sugar-growing area, had massive floods and then got hit by a cyclone."
Not all the news is bad for consumers. Milk
production remains high, despite the poor prices dairy producers are receiving.
And the total amount the average U.S. family spends on food continues to be
about 10 percent of their take-home income, compared with 40 percent to 50
percent in developing countries such as Bangladesh.
"When you see massive food price
inflation and food is half of your family's budget, it hurts substantially
more," Alexander said.
http://www.seedquest.com/news.php?type=news&id_article=15320&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.03 A Hybrid Path to
Feeding 9 Billion on a Still-Green Planet
By ANDREW C. REVKIN
Improvements in crop genetics and wasteful,
inefficient farming and food management provide the biggest gains in a plan to
triple agricultural production on todayÕs global farm acreage, with the
potential shifts displayed above. This vision of a path to feeding roughly 9
billion people with rising living standards, while also limiting deforestation
and other damage to ecosystems, comes from Jason Clay, a longtime analyst of the
intersection of food and the environment and a senior vice president of the
World Wildlife Fund.
HereÕs his draft paper on this
strategy. The genetic work he describes includes all uses of genetic research
to improve plant productivity or farming efficiency. Genetic modification, the
realm of the GMOÕs that are anathema to some environmentalists and much of
Europe, is a subset of that arena. [At the Climate, Mind and Behavior
Conference of the Garrison Institute on Thursday, Clay laid out the logic behind
working with big corporations to foster food production that can fit on a
finite planet. He made a point that he stressed at the recent annual
meeting of the American Association for the Advancement of science: "In
the next 40 years we're going to have to produce as much food as was produced
in last 8,000."]
ClayÕs work builds in part on the research
of Jon Foley, the director of the Institute of the Environment at the
University of Minnesota. I encourage you to review FoleyÕs argument for a
resilient hybrid strategy. HereÕs how he put it in an interview with Earth
& Sky:
I think we need a new kind of agriculture
– kind of a third agriculture, between the big agribusiness, commercial
approach to agriculture, and the lessons from organic and local systemsÉ. Can
we take the best of both of these and invent a more sustainable, and scalable
agriculture? [Read, and hear, his answer..]
HereÕs a bigger question. Given the glaring
yield gaps between rich and poor places, particularly, can campaigners and
citizens passionate about environmental conservation (and ÒgreenÓ eating) learn
to embrace the need, in many crops and situations, for intensification as
a path to a greener, thriving world?
Read this piece in Nature on http://www.nature.com/news/2010/100728/full/466542a.html on the growing debate within Europe about the
potential costs to that region in lost innovative capacity in agriculture if
its barriers to genetic work persist:
Some farmers have also criticized the
proposal, fearing that it will drive investment in agrobiotech away from Europe
and make their industry less competitive. ÒThis decision sends a clear signal
to the rest of the world that the EU lacks interest in innovation and new
technologies for a competitive agriculture industry and that it does not use
evidence and science in its decision-making,Ó the UK National Farmers UnionÕs
chief science and regulatory affairs adviser, Helen Ferrier, said in a
statement. ÒThe very real danger is that it risks discouraging technology
companies investing in Europe.Ó
Meanwhile, environmental groups such as
Friends of the Earth and Greenpeace are concerned that devolving
decision-making on GM crops will make it more difficult to block their
development.
My guess is that EuropeÕs resistance will
fade as China pushes ever harder and as African countries, particularly, begin
to recognize the gains — where they fit — from these technologies.
Contributed by
Rodomiro Ortiz
(Return to Contents)
++++++++++++++++++++++
1.04 Forty Findings on the Impacts of CGIAR Research
1971–2011
The collaborative work of the Consultative
Group on International Agricultural Research (CGIAR) has resulted in
development impacts on a scale that is without parallel in the international
community. They are the result of Òinternational public goods,Ó including
improved crop varieties, better farming methods, incisive policy analysis and
associated new knowledge. These products are made freely available to national
partners, who transform them into locally relevant products that respond
effectively to the needs of rural households in developing countries. Following
are 40 largely quantitative findings on CGIAR impacts since its inception in
1971. Most were gleaned from a 2010 Food Policy journal article authored
by Mitch Renkow of North Carolina State University in the USA and Derek
Byerlee, a former adviser in the World BankÕs Agriculture and Rural Development
Department and co-author of the World Development Report 2008: Agriculture
for Development. The article provides a quite comprehensive overview of hard
evidence published in the last decade on CGIAR research impacts.
Much
of this impact has resulted from collaborative research on crop improvement,
whose products figured so importantly in the Green Revolution and in subsequent
efforts to extend the initial gains in agricultural productivity.
1 As a result of crop improvement research within
and beyond the CGIAR, 65 percent of the total area planted to the worldÕs 10
most important food crops is sown to improved varieties.
2 About 60 percent of the food crop area planted to
improved varieties is occupied by many of the approximately 7,250 varieties
resulting from CGIAR research.
3 A 2008 study put the overall annual economic
benefits of CGIAR research on the three main cereals alone at about US$0.8 billion
for maize, $2.5 billion for wheat and $10.8 billion for rice in Asia alone, far
exceeding the investment in this work.
4 For these three crops, research on genetic
improvement has made possible rates of yield growth that vary in recent years
from 0.7 to 1 percent annually.
5 According to a 2008 study on potato improvement,
varieties originating from the CGIAR are now planted to more than 1 million
hectares, double the area documented just 5 years before.
6 The estimated rates of return on the CGIARÕs
investment in all crop improvement research range from 39 percent in Latin
America to more than 100 percent in Asia and in the Middle East and North
Africa. For small-scale farmers, the appeal of improved crop varieties lies not
just in their higher yields but in their resistance to diseases and pests and
their adaptation to physical stresses like drought, traits that translate into
more stable yields over time.
7 Recent research documents a steady decline in the
variability of maize and wheat yields over the last 40 years, which is
statistically associated with the spread of more stress-resistant varieties.
8 More stable maize and wheat yields generate
benefits with an estimated annual value of US$149 million and $143 million,
respectively, more than the total amounts spent annually on maize and wheat
breeding for the developing world.
9 Research aimed at maintaining resistance to a
single major disease of wheat — leaf rust — generated benefits from
1973 to 2007 that are currently worth $5.4 billion.
10 A 2009 study aimed at quantifying benefits from
CGIAR research on yield stability estimated that the global economic value of
genetic resistance to various wheat diseases amounts to as much as $2.0 billion
annually. Diseases also pose a major threat to livestock production. Solutions,
such as vaccines, are now being rolled out and could generate large impacts.
11 The production and delivery of a vaccine for East
Coast fever — a tick-transmitted disease that threatens some 25 million
cattle in 11 countries of eastern, central and southern Africa — is being
placed in the hands of private sector partners. It is expected to save more
than a million cattle, with benefits worth up to US$270 million a year in the
countries where the disease is now endemic.
As
the impacts of climate change emerge, including more frequent and severe
drought and flooding, CGIAR crop improvement research is developing new and
more resilient generations of cereal varieties:
12 More than 50 new varieties with drought tolerance
have been adopted on a total of about 1 million hectares across eastern and
southern Africa, giving an average yield advantage of 20-50 percent. A 2010
study projects that further adoption of these maize varieties could boost
harvests in 13 African countries by 10-34%, generating up to US$1.5 billion in
benefits for producers and consumers.
13 A novel approach to seed dissemination has put a
new rice variety in the hands of 100,000 Indian farmers within one year after
its release in 2009. The new variety offers a yield advantage of 1 ton per
hectare, even if submerged for 2 weeks, making it an attractive option for
IndiaÕs 12 million hectares of flood-prone agricultural land.
A
landmark 2003 study on the impact of crop improvement research from 1965 to
1998 painted a counterfactual scenario of what the global food system would be
like without CGIAR research. It concluded that:
14 Developing countries would be producing 7-8
percent less food.
15 Their cultivated area would be 11-13 million
hectares greater at the expense primary forests and other fragile environments.
16 Their per capita food consumption would be 5
percent lower, on average.
17 Some 13-15 million more children would be malnourished.
18 The study also noted that for every US$1 dollar
invested in CGIAR research, $9 worth of additional food is produced in
developing countries.
Precisely
because major impacts can be realized only through collaborative research, the
CGIAR has made a considerable effort over the years (accounting for roughly 20
percent of its expenditures) to strengthen the capacity of national partners
through formal and informal training as well as other learning activities.
19 An estimated 80,000 professionals have received
such training so far. According to an external evaluation carried out in 2006,
this work is highly relevant to national capacity needs and of high quality,
judging from the results of trainee surveys. Evidence from seven country case
studies suggests that CGIAR training is a Òsignificant contributor to positive
outcomes from research.Ó
In
addition to improving all of the worldÕs major food crops, CGIAR researchers
have achieved, for the first time ever, dramatic productivity gains in a tropical
food fish.
20 Selective breeding of the Nile tilapia resulted in
a highly productive strain that grows faster and survives better than local
ones, offering yields that are 25 to nearly 80 percent higher in the five
Southeast Asian countries where the Òsuper tilapiaÓ was introduced and
evaluated during the mid-1990s. In all of these countries, the new strain has
generated additional income and employment on both large- and small-scale fish
farms, while lowering market prices by about 10 percent and thus benefiting
consumers significantly. In the Philippines alone, increased employment in the
tilapia industry has benefited 300,000 people.
A
large amount of evidence compiled since the 1990s indicates that gains in
developing country food production have contributed importantly to poverty
reduction by raising farm incomes, creating employment for farm workers,
reducing the price of food and fueling economic growth.
21 A 2007 study showed that CGIAR research on rice
enabled more than 6.75 million Chinese to escape poverty between 1981 and 1999,
primarily as a result of lower grain prices made possible by increased crop
production.
22 The poverty reduction numbers for India are even
more impressive — 14 million people moved out of poverty between 1991 and
1999. Several studies published in recent years have documented the impacts of
the CGIAR as a whole either at the global level or in specific regions.
23 The economic benefits of the CGIAR as a whole were
estimated to range from about US$14 billion to more than $120 billion. Even
under quite conservative assumptions, the benefits of research have been
roughly double the investment.
24 A 2007 review of investments in agricultural
research carried out by five CGIAR Centers and their partners in South Asia
during the post-Green Revolution period (i.e., since the early 1980s) found
average annual benefits of more than $1 billion from research on maize, rice
and wheat alone, far above the CGIARÕs total annual expenditures in the region.
CGIAR
research has had less impact in Africa than in Asia, but work in the former
region began a decade later and under quite difficult conditions. Even so, a
number of impact studies suggest that African agriculture can produce successes
on a par with those unfolding elsewhere, delivering large returns on the
CGIARÕs significant investment in the region.
25 In the late 1980s, Africa witnessed one of the
CGIARÕs most spectacular research achievements since the Green Revolution
— biological control of two devastating insect pests of the tropical root
crop cassava. The economic returns — reaching a current value US$9
billion for research on just one of the pests, the cassava mealybug — far
exceed the CGIARÕs total investment in Africa since 1971.
Crop
research has yielded important results in Africa as well.
26 As a result of maize improvement in West and
Central Africa from 1971 to 2005, farmers are planting improved varieties,
derived mostly from CGIAR research, on about 60 percent of the total maize
area, with economic benefits estimated at $2.9 billion annually.
27 Improved varieties of cowpea, which provide both
food and livestock feed, are being widely adopted in the dry savannas of West
Africa, with estimated benefits of $299 million to $1.1 billion expected to
accrue during 2000-2020.
28 Impressive gains have also been registered in
Eastern and Southern Africa, where improved varieties of common bean, developed
with farmer participation, have been adopted on about 50 percent of the total
bean area over about 15 years, according to a 2008 study. It estimates that the
new varieties are strengthening food security and raising incomes in 5.3
million rural households. The benefits of bean improvement research for Africa
are estimated to have a current value of roughly $200 million, compared to costs
of about $16 million.
29 New Rice for Africa, or NERICA, which combines the
high yields of Asian rice with African riceÕs resistance to local pests and
diseases, has spread to about 250,000 hectares in upland areas, helping reduce
national rice import bills and generating higher incomes in rural communities.
30 Recent research has also begun to document
nutritional benefits from improved crop varieties. In Mozambique, the
introduction of new orange-fleshed sweet potato significantly increased the
intake of vitamin A among young children in 850 households, according to a 2007
study.
The
results of CGIAR research on natural resource management have proved harder to
implement and evaluate than its work on crop improvement. Nonetheless, a set of
seven case studies published in 2007 indicates that this research is giving
highly positive returns on investment, based just on the benefits for
agricultural productivity. If methodologies were available for gauging the
environmental benefits as well, the returns would no doubt be much higher.
31 The practice of no-tillage, which is spreading
rapidly in the rice-wheat systems of South AsiaÕs Indo-Gangetic Plain, has been
shown to reduce farmersÕ production costs by 10 percent and to raise crop
productivity by the same amount, generating economic benefits on the order of US$165
million since 1990. This does not include the substantial environmental gains
resulting from the conservation of water, sequestration of carbon in the soil
and reduction of greenhouse gas emissions.
32 By 2002, more than 66,000 farmers in Zambia had adopted
an agroforestry system called Òfertilizer tree fallows,Ó which renews soil
fertility using on-farm resources. The system has been shown to boost maize
production while reducing production risks and soil erosion, with benefits of
up to $20 million, compared with an investment of about $3.5 million.
33 In Malawi, an integrated agriculture-aquaculture
system, introduced during the mid-1990s with active farmer participation at a
cost of $1.5 million, has created benefits worth nearly $3.5 million by doubling
the income of rural households and dramatically increasing fish consumption.
The system shows great promise for other areas of southern Africa where the
agricultural labor force has been devastated by HIV/AIDS.
34 New information and tools provided to
conservationists during the 1990s is being used to monitor some 37 million
hectares of forest globally, resulting in better management of this diminishing
resource and contributing to more sustainable livelihoods for forest dwellers.
Development
impact depends not just on new technologies but on better policies that offer
rural people the means and incentives to invest in sustainable agricultural
production and resource use. While hard to measure, the impacts of CGIAR policy
research and advocacy appear to be substantial, as suggested by recent case
studies indicating benefits worth millions of dollars.
35 Research on the liberalization of rice prices in
Vietnam during the mid-1990s led to the relaxation of rice export quotas and of
internal restrictions on trade, generating benefits worth US$45-91 million.
36 A food-for-education program in Bangladesh,
catering to 2.1 million students in 17,811 schools, created total benefits
estimated at $248 million, with the aid of capacity building and policy research,
which guided the conception, evaluation and targeting of the initiative
starting in the early 1990s.
37 Recent work on the political economy of
IndonesiaÕs pulp and paper sector has given rise to more sustainable production
practices, more effective regulation and other interventions, with benefits
totaling $19-21 million.
38 Shifts in SyriaÕs policies on fertilizer
distribution and barley prices in arid zones starting in the mid-1980s have
contributed to increased barley output through more efficient fertilizer use,
leading to improved livestock nutrition, with benefits worth $73.4 million.
39 Research and advocacy aimed at decriminalizing the
marketing of milk by small-scale vendors in Kenya created benefits for
producers and consumers having an estimated value of $44-283 million.
40 In the Philippines, improved policies on
pesticides — starting in the late 1980s and involving the regulation of
highly toxic products on rice and the training of rural health officers —
has resulted so far in benefits valued at $117 million.
http://cgiar.org/pdf/Forty-findings-CGIAR%20_March2011.pdf
Contributed by Rodomiro Ortiz
(Return to Contents)
+++++++++++++++++++++++
1.05 Bioenergy crops
could lower surface temperatures, Stanford University researchers say
Stanford, California, USA
March 10, 2011
Concerns about the impact of corn ethanol
on global warming have raised interest in more eco-friendly perennial grasses.
A new study finds that large-scale cultivation of perennials could actually
reduce regional surface temperatures.
Converting large swaths of farmland to
perennial grasses for biofuels could lower regional surface temperatures,
according to a recent Stanford study.
The study, published online in the Feb. 28
edition of the Proceedings of the National Academy of Sciences (PNAS), comes on the heels of federal initiatives to wean the United States off fossil fuels by
mandating significant increases in ethanol production. The Department of Agriculture forecasts that by 2018, more than one-third of the
country's corn harvest will be used to produce ethanol.
But concerns about the impact of corn
ethanol on food prices, deforestation and global warming have raised interest
in the cultivation of perennial grasses – such as switchgrass – as
alternative sources of biofuel. Previous studies suggest that ethanol made from
switchgrass emits less carbon dioxide than corn-derived ethanol and would
therefore have less of an impact on global warming.
In the PNAS study, researchers found
that widespread cultivation of perennial grasses could actually reduce the
surface temperature of Earth at a regional scale.
"We've shown that planting perennial
bioenergy crops can lower surface temperatures by about 2 degrees Fahrenheit [1
C] locally, averaged over the entire growing season," said study co-author
David Lobell,
assistant professor of environmental Earth system science and a center fellow at
Stanford's Program on Food Security and the Environment. "That's a pretty big effect, enough to
dominate any effects of carbon savings on the regional climate."
In the study, Lobell and his colleagues used
a computer simulation to forecast the climatic effects of converting
farmland in the Midwest from annual crops – like corn and soybeans
– to perennial grasses. The results showed that large-scale perennial
cultivation in the 12-state area would pump significantly more water from the
soil to the atmosphere, producing enough water vapor to cool the local surface
temperature by 1.8 F.
"Locally, the simulated cooling is
sufficiently large to partially offset projected warming due to increasing
greenhouse gases over the next few decades," the authors wrote.
"A key issue remaining is whether the
additional water being pumped from the soil gets fully replenished by rainfall,
or whether in the long term the soil dries and can't support the same amount of
crop production," Lobell said.
"More study is needed to understand
the long-term implication for regional water balance," added lead author Matei Georgescu of the Center for Environmental Fluid Dynamics at Arizona State University. "This study
focused on temperature, but the more general point is that simply assessing the
impacts on carbon and greenhouse gases overlooks important features that we
cannot ignore if we want a bioenergy path that is sustainable over the long
haul."
The PNAS study was also co-authored
by Chris Field,
professor of environmental Earth system science and of biology
at Stanford. Field is also a senior fellow at Stanford's Woods
Institute for the Environment
and director of the Carnegie Institution's Department of Global Ecology. The research was made possible through support
from the Stanford Global Climate and Energy Project and a National Science Foundation grant at Arizona State University.
The Program on Food Security and the
Environment is a partnership of the Woods Institute for the Environment and the
Freeman
Spogli Institute for International Studies at Stanford.
http://www.seedquest.com/news.php?type=news&id_article=15371&id_region=&id_category=&id_crop=
Source:
SeedQuest.com
(Return to Contents)
++++++++++++++++++++++++
1.06 About the National Association of Plant Breeding
(USA)
NAPB is primarily focused on US-relevant
plant breeding issues. NAPB now has over 900 members, and continues to
expand rapidly. These members are professionals, staff, students, public,
philanthropic, commercial, domestic and international, and work on all sorts of
plants and plant breeding topics. To join NAPB (no cost), see our NAPB website,
or send an email to David Stelly (NAPB Secretary) with "NAPB - REQUEST TO
JOIN". \The Plant Breeding Coordinating Committee is an
advisory group on plant breeding in the US.
NAPB Website:
Have you seen our re-designed
website? We need to thank Seth Murray for this. The NAPB website is the
focal point of plant breeding activities with highlights on what the NAPB and
PBCC can do for you (About), Hot Topics, Meetings, Awards, Careers, including
links to jobs through Associations and Seedquest and free resume posting; links
to Plant Breeding programs in the US and partners. Please visit National
Association of Plant Breeders (http://www.plantbreeding.org) and feel free to provide us with any information
to keep our website relevant.
Education:
The education committee has been working
hard to build capacity to develop educational information (see links, careers
and hot topics) and keep our members updated on the latest educational
opportunities such as courses. Examples include Illinois Corn Breeders School,
Plant Breeding Academy and links to websites such as the USDA extension website
on Plant Breeding and Genomics. Additionally, the first journal article from
the UC Davis Delphi study, "Designing graduate level plant breeding
curriculum: A Delphi study of private sector stakeholder opinions", was
accepted for publication in the Journal of Natural Resources and Life Sciences
Education. For more information regarding the article please visit http://sbc.ucdavis.edu/education/delphi_study.html. Please help us keep up-to date on any
further plant breeding education activities. Please help us keep up-to date.
Source: Excerpted from Newsletter 1, March 17, 2011 by the editor, PBN-L)
(Return to Contents)
+++++++++++++++++++++++
1.07 One-pager on plant breeding from the National
Association of Plant Breeders (USA)
Our one-pager on sustaining plant breeding
has been posted on the NAPB website at:
Plant Breeding: It's a Journey, Not a Destination
(EditorÕs note: figures excluded from the
following version)
Food and fiber for an ever-increasing world population
The worldÕs population continues to increase,
doubling from 3 to 6 billion between 1960 and 1999. By 2050, the number of
humans is expected to exceed 9 billion. Providing food and fiber for this
enormous population is an ominous challenge facing humankind, without
significant addition of new arable lands, challenges of changing weather
patterns, and decreased quantity and quality of fresh water. Genetic selection
by plant breeders brought about the ÔGreen RevolutionÕ of the 1960s and 1970s
that increased production of major crops and saved millions in the developing
world from starvation. Plant breeders continue this success story by developing
superior crops to meet the world needs for food, fiber, and fuel.
Plant Breeding: Continuous investment pays
continuous dividends
Plant breeding is never complete. Long-term
support of plant breeding is the major reason why the USA still leads the world
in agriculture, fueling economic growth, new businesses, and new jobs. TodayÕs
high-quality, superior-yielding crops are the foundations of even better plants
for tomorrow. However continuous increases in crop productivity and quality are
directly tied to sustained investment in plant-breeding personnel and
infrastructure, such as research stations, greenhouses, labor and materials for
crossing and selection, etc. Examples for which long-term investment in plant
breeding have paid off handsomely include:
Plant breeders rely on sustained funding
for long-term selection of crops to address such challenges as:
á Increased global trade introducing exotic
pests or pathogens;
á Higher mean temperatures and humidity
making endemic diseases and
pests more serious;
á Drought and reduced access to fresh water
contributing to significant yield
reductions;
á Increasing input costs for fuels and
fertilizers.
Recommendations:
Sustained funding of plant breeding by
commodity groups, private industries, USDA, and other state or federal agencies
to:
á Support the infrastructure and long-term
commitment required to develop superior crops for US production and global
consumption;
á Train the next generation of plant
breeders to address the needs of a growing world population with fewer inputs and decreasing arable
land.
For more information:
Please visit the website of the National
Association of Plant Breeders (NAPB) at http://www.plantbreeding.org/napb/sustainingplantbreeding.html
Mike Havey
Vice-Chair of PBCC
University of Wisconsin
(Return to Contents)
1.08 Plant Breeding
Academy training has a big impact on career development
Davis, California, USA
March 15, 2011
A recent survey of UC Davis Plant Breeding
Academy (PBA) graduates shows that the program has a significant impact on both
the employer and the graduate-employee. Graduates from the first two classes
were surveyed with three statements measuring the impact of PBA on: 1) the
contribution the graduates make to their organizations and 2) recognition they
have received for their contributions. The graduates enthusiastically
participated in the survey with more than 50% of them mailing in responses
within the first 3 days of our inquiry.
Eighty-nine percent of respondents agree or
strongly agree that they have become more productive employees in their
respective organizations; 72.2% of respondents agree or strongly agree that the
complexity of their tasks and duties have increased as a result of PBA
training; more than 55% of the respondents experienced positive career changes
in terms of promotion and salary.
Dr. Rale Gjuric, Education Director, Seed
Biotechnology Center, UC Davis reflects on the results of the survey and
success of the program: ÒIt is great to confirm that our graduates and their
employers are benefiting from the training received through the PBA. It gives
us a The UC Davis Plant Breeding Academy is a postgraduate program that teaches
the fundamentals of plant breeding, genetics and statistics through lectures,
discussion, and field trips to public and private breeding programs. Employers
appreciate the opportunity to provide their valued employees advanced training
without disrupting their full-time employment. Participants attend six 6-day
sessions over the period of two years. The instructors are internationally
recognized experts in plant breeding and seed technology. great satisfaction
and sense of purpose. The recognition by the employers is another measure of
industry satisfaction with the program. The European PBA Class I and PBA Class
III are currently in progress, adding thirty more graduates by the end of 2012.
With the success of the European program and anticipated expansion to Asia, we
expect to have a total of over 100 PBA graduates by 2014.Ó
http://www.seedquest.com/news.php?type=news&id_article=15414&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
+++++++++++++++++++++++
1.09 University of
Missouri researcher leads new $6.6 million study that could lead to better corn
plants
Columbia, Missouri, USA
March 14, 2011
Plants harvest energy through the process
of photosynthesis, using sunlight to produce sugars. However, little is known
about the genes that regulate the transport of sugars to build different parts
of the plant. Now, a University of Missouri researcher has received a $6.6
million grant from the National Science Foundation to lead a research team to
study the genes that control the movement of carbohydrates in corn. This
research may lead to increased yield, more drought resistant plants, larger
plants and easier production of biofuels.
ÒWhen corn produces carbohydrates in the
leaves, it transports sucrose, a type of sugar, to other parts of the plant,
including the ears and roots,Ó said David Braun (photo), an associate professor
in the Division of Biological Sciences in the College of Arts and Science and a
member of the MU Interdisciplinary Plant Group. ÒBy understanding how the
movement of carbohydrates is regulated, we may be able to engineer plants that
better meet the needs of farmers and consumers.Ó
Braun said that the carbohydrate transport
process for corn is similar to a highway system. Sucrose produced in leaves
travels Òdown the roadÓ toward an eventual exit, but it has points where the
traffic does not flow properly and the Òexit ramp trafficÓ backs-up into the
roadway. Braun plans to find these bottlenecks, so future research can focus on
increasing traffic flow towards these Òexit ramps,Ó such as the root system or
ears of the plant. Getting more energy to these plant organs may enable the
plant to grow larger or hardier.
In the future, researchers may be able to
use this knowledge to engineer plants with certain qualities. For example,
researchers could attempt to improve carbohydrate flow to ears to increase
yield, or to the roots to make the plant more drought resistant.
ÒCarbohydrate transport is one of the least
understood but most important factors in plant development,Ó Braun said. ÒThis
research has the potential to have a great effect on corn farming, not just for
increasing yield, but on so many other aspects.Ó
Braun thinks this research also may enhance
the production of biofuels. In addition to carbohydrates being transported
throughout the plant for growth, some sugar is converted to cellulose, an
organic compound that comprises the plant cell walls. Cellulose is more
difficult for processers to convert into biofuel than sucrose. Braun thinks
this research may indicate ways that plants could be modified to store more of
the carbohydrate as sucrose. With more sucrose in the plant, biofuels could
become cheaper to produce and consumers might experience lower prices, leading
to increased use.
Braun leads a team of researchers from the
University of Florida, Purdue University, the University of Nebraska-Lincoln,
and St. MichaelÕs College in Vermont. Funding for the project was provided by a
grant from the Plant Genome Research Program of the National Science
Foundation.
http://www.seedquest.com/news.php?type=news&id_article=15455&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.10 Iowa State
UniversityÕs new plant breeding masterÕs degree to serve career professionals
remotely
Ames, Iowa, USA
March 16, 2011
Plant breeders from around the world will
soon have access to an advanced degree in their field though a new distance
learning Master of Science program offered through the agronomy department at
Iowa State University.
The program, believed to be the first of
its kind, will be available this fall and is designed for plant breeding
professionals who want to advance their careers, said Thomas LŸbberstedt
(photo), professor, K.J. Frey Chair in agronomy and director of the program.
ÒWe started developing the courses after
meeting with breeding companies, both large and small, to find out if a program
like this was needed,Ó said LŸbberstedt.
ÒWe have designed the program with
studentsÕ needs in mind,Ó he added.
Even before the first student takes a
course, research has been done on those needs.
ÒSponsored by the USDA, we started the
whole thing with a survey sent to plant breeding companies,Ó said LŸbberstedt.
ÒThis allowed us to learn what they want, and also let them know that this
would soon be available.Ó
Survey feedback led to the development of
the program that consists of 12 courses and a creative component.
Requirements for the Master of Science in
plant breeding could be completed in as little as two years, but most students
will probably take four or five years, because they are likely to be working
professionals, said LŸbberstedt.
ISU will continue to offer the on-campus version
of the degree.
The distance learning plant breeding
program is patterned after the very successful distance Master of Science in
agronomy program the department launched in 1997. That program has grown to
more than 155 active students and has conferred 79 advanced degrees.
Potential students have shown a similar
high level of interest in the plant breeding program even though it isnÕt
officially launched yet, said LŸbberstedt.
Janika Eckert, co-owner and plant breeder
for JohnnyÕs Selected Seeds in Maine, is eager to start her masterÕs in the new
ISU program.
ÒMostly, what interests me about continuing
education is the opportunity to improve myself, my capabilities and my job
performance,Ó she said. ÒBy this, I mean that I hope to breed more and better
varieties for our customers.Ó
Offering the plant breeding courses through
a distance education format presented unique challenges, said LŸbberstedt.
ÒThere was some debate about offering this
course where students are expected to work with plants in the field,Ó he said.
ÒBut because most of these students will already be employees of plant breeding
companies, they have substantial field experience.Ó
Getting the coursework remotely will also
be helpful to potential students such as Jasmine Lopez of Fort Myers, Fla., an
assistant plant scientist at Syngenta.
Ò[ItÕs a] great program for working
professionals who want to develop their career and at the same time want to go
back home at night to see their family,Ó Lopez said.
According to the ISU agronomy website,
plant breeding is the science and art of improving crop plants through the
study and application of genetics, agronomy, statistics, plant pathology,
entomology, and related sciences.
http://www.seedquest.com/news.php?type=news&id_article=15459&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.11 Cucurbit breeding
activities in Southeast Asia capture attention of seed company representatives
Tainan, Taiwan
March 11, 2011
Source: Newsletter of the AVRDC, The
World Vegetable Center
D.A.A. Deshpande and M.K. Pande of JK Agri
Genetics Ltd., a member of the Asia Pacific Seed Association (APSA), visited
AVRDCÕs Regional Office for East and Southeast Asia on 23 February 2011 to
discuss opportunities for research collaboration.
The visitors were particularly impressed
with AVRDCÕs pumpkin and bitter gourd breeding activities, led by cucurbit
breeder Narinder Dhillon.
Drs. Deshpande and Pande also toured
Kasetsart UniversityÕs (KU) tomato and chili fields together with Krung
Sitadthani, a vegetable breeder from KUÕs Tropical Vegetable Research Center
(TVRC).
Full article
http://www.seedquest.com/news.php?type=news&id_article=15323&id_region=&id_category=&id_crop=
Source:
SeedQuest.com
(Return to Contents)
1.12 Pearl millet set
for release in India next year
Micronutrient deficiency is very rampant in
the undernourished populations of South Asia. This is the reason why
HarvestPlus and its partners are continuously developing the nutrient contents
of staple crops commonly eaten by the poor. In 2012, high-iron pearl millet,
the first biofortified crop, will be released in India. According to
reports, 70% of children below 5 in states of Rajasthan, Maharashtra, Gujarat,
and Uttar Pradesh where pearl millet is a staple food, are anemic due to lack
of iron intake.
"These will be higher yielding and
will also have a high iron content," says Dr. Kedar Rai, Director of the
HarvestPlus India Biofortification Program. This will not just boost the income
of farmers, but also improve the health condition of their families.
High-zinc varieties of rice and wheat are
also being developed and scheduled for release in 2013.
Read more at http://www.harvestplus.org/content/pearl-millet-set-release-2012
Source: Crop Biotech Update 11 February
2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
(Return to Contents)
1.13 New rice variety
could ease MozambiqueÕs grain supply
A new rice variety will soon benefit
farmers in Mozambique. This new rice variety technically known as
IR80482-64-3-3-3 and developed by scientists at the International Rice Research
Institute, were sent to Mozambique for testing. Results showed that the average
yield is seven tons per hectare, which is 95 percent higher than the present
varieties planted in the country. It also exhibited better resistance to
diseases such as fungal blast and bacterial blight, which is a relief to small
farmers who cannot afford to purchase commercial pesticides.
The new rice variety has been approved by
the registration and release committee at Mozambique's Ministry of Agriculture
in December 2010 and will be forwarded to IIAM's seed office for reproduction
before delivery to factories for certification and distribution to farmers.
Read more at http://allafrica.com/stories/201102141280.html
Source: Crop Biotech Update 18 February
2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.14 PHILRICE Recommends
better rice varieties for irrigated lowland
The Philippine Rice Research Institute
(PhilRice) is promoting new high yielding rice varieties with maximum yield
potential of 9-12 tons per hectare (t/ha), which has a 1t/ha advantage over the
previously bred varieties. These new varieties that are best suited for
irrigated lowlands include NSIC Rc212 (Tubigan 15), Rc214 (Tubigan 16), Rc216
(Tubigan 17), Rc222 (Tubigan 18), Rc224 (Tubigan 19), and Rc226 (Tubigan 20).
Registering better performance than the check varieties, PSB Rc82 and PSB Rc18,
NSIC Rc212 and NSIC Rc214 could yield up to 10 t/ha when transplanted and have
an average yield of 6 t/ha. These varieties are bred to help farmers increase
their production.
For more information regarding these new
varieties, visit http://www.philrice.gov.ph/index.php?option=com_content&task=view&id=1251&Itemid=1
Source: Crop Biotech Update 11 March 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics, Cornell
University
Mes25@cornell.edu
(Return to Contents)
1.15 Hands-on training for ÒRice Seed ProductionÓ
Bagamoyo, Tanzania
7-10 March, 2011
IRRI regional office based at
Dar-es-Salaam, Tanzania organized a hands-on training for Ôrice seed
productionÕ at IRRI research farm, Bagamoyo from 7 to 10 March 2011, especially
for the researchers from eastern and southern Africa (ESA). Logistics of the
training was funded by Japan Rice Breeding Project (JRBP) while travel
component was supported by the parent organization of the candidates. Training
involved 20 participants including 4 female candidates, mostly researchers and
few extensionists form public and private organisation from Rwanda, Burundi,
Ethiopia, Uganda, Mozambique and Tanzania. The training course content included
Rice morphology for clear understanding of the plant while identifying the
off-types, nursery raising and management, transplanting of the seedlings,
concept of panicle to row for nucleus and breeder seed production, observations
and rouging of the commercial seed plots and critical stages, and harvesting
and post-harvesting operations and labelling. This training involved minimal
classroom presentation and maximum field work. Participants enjoyed working in
field on their own as we provided them the practical learning materials at
different growth stages using staggered plantings. Dr. RK Singh, senior scientist and regional plant breeding
coordinator for ESA was the course coordinator while Dr. Zak Kanyeka, regional
training coordinator for ESA, coordinated the training activities. Dr. YP
Singh, consultant (crop production), Mr. Mohammed Mkuya, researcher and Dr.
Rosemary Mutegi-Murori acted as facilitator for this training activities.
Contributed
by R.K. Singh
Senior
Scientist (Regional Plant Breeding Coordinator for Eastern and Southern
Africa),
IRRI-AfricaRice
Office, Mikocheni B,
(Return to Contents)
1.16 Why enhanced
cooperation on patent protection is a step towards enhanced innovation
Brussels, Belgium
10 March 2011
EuropaBio believes the adoption today of
the Competitiveness Council conclusions in favour of an enhanced cooperation
procedure in the area of the creation of a unitary patent protection system is
an important step in the right direction towards truly supporting innovation
and value creation in Europe.
Commenting on the development, Tom Saylor,
Chair of EuropaBioÕs SME Platform said: ÒOur highly innovative companies, large
and small alike, compete on the global scene and are confronted with
increasingly high costs of patenting under the current system in Europe. In
order for it to remain attractive for innovative companies such as ours to develop
and flourish in Europe, these patent costs must come down and Europe must agree
on a competent centralized court of patent adjudication. We need to create the
right environment in Europe to compete with other high-tech regions in the
world so that our companies chose Europe to market the products that help
citizens lead longer, healthier and greener lives.Ó
The European biotech industry pioneers
breakthroughs in research and development in key strategic fields to satisfy
unmet medical needs and to provide more sustainable agricultural and industrial
products and processes for future generations. The work of these sectors must
be enabled if Europe is to realise the value of its strong scientific base
through the commercialisation of the products of European biotech and to retain
the benefits, value and employment in the EU.
Nathalie Moll, Secretary General of
EuropaBio, concluded: ÒWe are encouraged by the Ministers agreement on an
enhanced cooperation procedure which represents a step in the right direction
towards achieving the three core goals set out by the EU 2020 Strategy. We now
urge the European Institutions and member states to ensure that the
jurisdictional regime is addressed as soon as possible to make enhanced
cooperation an operational success. We must also not forget that in the
meantime, the ratification of the London Agreement1 by Member States should
continue to be a priority. Ó
- Council of the European Union press
release
- Background: Towards a unitary
patent protection in Europe
http://www.seedquest.com/news.php?type=news&id_article=15295&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.17 FAO seed treaty
carries hope, addressing country contributions, farmers concerns
Geneva, Switzerland
30 March 2011
By Catherine Saez
Funding mechanisms and farmersÕ rights were
among the issues that captured the attention of member countries of the International
Treaty on Plant Genetic Resources for Food and Agriculture during the biannual
meeting of its Governing Body.
The fourth session of the Governing Body of
the treaty took place in Bali, Indonesia, from 14-18 March.
The United Nations Food and Agriculture
OrganizationÕs International Treaty on Plant Genetic Resources for Food and
Agriculture, based in Rome, seeks to establish a global system to provide
treaty users access to global plant genetic materials, with a system of benefit
sharing to remunerate countries from which those materials originate if
commercial benefits are accrued. It also means to help alleviate hunger and
climate change effects.
Among outcomes of the meeting was the
adoption of a resolution on farmersÕ rights; completion of the information
technology infrastructure of the treaty; and completion of the dispute
resolution procedure for standard material transfer agreements (SMTAs). Also,
the Governing Body adopted a customised mediation procedure, and approved a resolution on the funding strategy for the treaty, dedicating
more than US$10 million to the second round of projects of the benefit-sharing
fund.
Winds of Discontent Blowing on FarmersÕ
Rights
One of the main new developments at the
governing body meeting was Òa mounting interest and pressure on farmersÕ rights
under the Treaty,Ó Shakeel Bhatti, secretary of the treaty, told Intellectual
Property Watch after the meeting. There is an increasing interest of
countries and civil society organisations in Article 9 of the treaty, Òwhich
recognises the farmersÕ rights, subject to national laws and policies,Ó he
said.
During the meeting, farmers organisations
were vocal in their concerns about farmersÕ rights. La Via Campesina, an
international peasantsÕ organisation representing about 200 million farmers, said
in a 16 March release, that there was a denial of famersÕ rights in many countries. ÒNothing
suggestsÓ that industry will pay for benefit-sharing, they said, adding that
most governments were implementing the rights of breeders in Òdenial of
farmersÕ rights.Ó
FarmersÕ rights include the ability to use,
sell and exchange seeds and this ability is not widespread, according to
farmers. ÒHere in Indonesia, farmers have been thrown in jail for re-sowing
part of their own harvest,Ó they said. IP rights on seeds are preventing the
further use, sale and exchange of seeds. ÒThe replacement of local seed for
hybrids or GMOs [genetically modified organisms] that farmers cannot replant
also infringe upon farmersÕ rights,Ó they said.
La Via Campesina also said that they
supported Òthe position of the African group that believed that the lack of
funding of the treaty or the implementation of farmersÕ rights must be regarded
as cases of non-compliance.Ó
ÒThe treaty adopted a resolution on
farmersÕ rights which requests the secretary to convene regional workshops on
farmersÕ rights, compile experiences and best practices received from
contracting parties on the implementation of farmersÕ rights, and to seek
assistance from appropriate sources in the provision of financial and technical
support to national governments for the realisation of farmersÕ rights,Ó Bhatti
said.
Article 9 of the treaty has three sections.
The first section recognises the contribution of farmers and local and
indigenous communities to crop diversity and conservation. The second section
agrees that the Òresponsibility for realising farmersÕ rights rests with
national governments.Ó It adds that Òin accordance with their needs and
priorities, each contracting party, should, as appropriate, subject to its
national legislation, take measures to protect and promote FarmersÕ Rights.Ó Those
rights include the protection of traditional knowledge, the right to equitably
participate in benefit sharing, and the right to participate in decision making
at national level.
The third section of Article 9 says that ÒNothing
in this Article shall be interpreted to limit any rights that farmers have to
save, use, exchange and sell farm-saved seed/propagating material, subject to
national law and as appropriate.Ó
In a closing statement on behalf of civil society, La Via Campesina said that the main purpose
of the treaty is Òto promote the conservation and sustainable useÓ of plant
genetic resources, and that the treaty Òcommits to support farmers as primary
beneficiaries of the treaty.Ó They demanded support and protection, and in
particular, the realisation of their Òinalienable farmersÕ rights to save, use,
exchange and sell our seeds and protect our knowledge.Ó
The farmers group warned against Òmonopoly
privileges for industrial plant breeders.Ó They also called on the governing
body to follow the advice of the UN Special Rapporteur on the Right to Food to
shift away from Òinput-intensive conventional farming towards agroecologyÓ (IPW,
United Nations, 9 March 2011).
The Governing Body adopted a resolution on
farmersÕ rights to be published shortly, they said.
Other Meeting Outcomes
According to Bhatti, among the results of
the Governing Body meeting is the completion of the access and benefit sharing
systems of the treaty, and in particular the completion of the information
technology infrastructure that will be the operational backbone of the global
gene pool, which now includes more than 1.5 million samples of genetic
material. The mainframe of the infrastructure is hosted in Geneva at the United
Nations Information and Computing Centre. The system will store all reported
standard material transfer agreements (SMTAs) and is under high security, he
told Intellectual Property Watch.
The dispute resolution procedure for SMTAs
was also completed, Bhatti said, and in particular on intellectual property
aspects and benefit sharing. The Governing Body adopted a customised mediation
procedure with arbitration carried out, in the last instance, by the
International Chamber of Commerce.
The Governing Body also reviewed the
mandate of the Ad Hoc Advisory Technical Committee on the SMTA and the
Multilateral System. This committee is in charge of addressing a range of legal
and technical aspects of the access and benefit sharing operations under the
multilateral system, including aspects on intellectual property. For example,
the committee would address the interpretation of which material would be
considered to be in the system by default, so in the public domain, and under
the control of contracting parties.
By ratifying the treaty, member countries
decide to exercise their sovereign rights over their crop genetic resources
through the Multilateral System of Access and Benefit-sharing, Bhatti told
Intellectual Property Watch. Under the treaty, the multilateral system includes
by default all genetic material listed in Annex I of the treaty and which are
in the public domain and under the direct management and control of the
contracting parties.
ÒAdditionally, contracting parties and
natural and legal persons within their jurisdictions may include further
agricultural plant genetic material, if they so wish, and multiple countries
have already done so, such as, for example, the Nordic Genebank (Denmark,
Finland, Iceland, Norway and Sweden) and the Dutch Centre for Genetic Resources
(CGN),Ó Bhatti said.
Countries Slow To Share Resources
According to some sources, only a minor
portion of the parties have notified which collections would be placed in the
multilateral system and provided the necessary documentation to facilitate
access. The vast majority of the genetic material is coming from previous
collections of the Consultative Group on International Agricultural Research
(CGIAR), they said.
According to Bhatti, countries that have
included material so far include Brazil, Canada, Czech Republic, Denmark,
Estonia, Finland, Germany, Iceland, Jordan, Lebanon, Madagascar, Malawi,
Namibia, the Netherlands, Norway, Portugal, Romania, Spain, Sudan, Switzerland,
the United Kingdom, and Zambia. The treaty now has 127 contracting parties,
according to a press release. An increasing number of countries are sharing their collections into
the treaty system, Bhatti said.
Assessing collections, often spread out
throughout the territory, can be a long process, a source said. Some countries
might want to evaluate how the system is working, including the benefit-sharing
mechanism, before they include additional material in the system. Another
source said those countries might not have yet established the legal system
needed to share their resources, but the Òcynical answer,Ó he said, might be
Òthat they want to get material from others but not grant others access to
their own.Ó
For the moment, Òthe genepool which the
multilateral system of the treaty creates is a virtual, legally constructed and
physically distributed pool of genetic material,Ó Bhatti said. ÒIt is not
located in a single physical genebank, but covers hundreds of collections of
genetic resources throughout the word.Ó
At present, Òmost of the known and
documented material within the genepool is located in the international
collections of the CGIAR,Ó he said. ÒThe treaty secretariat is partnering with
the Global Crop Diversity Trust, and Biodiversity International to create a
global accession-level information system, named ÔGeneSys,Õ which will contain
description of material in the multilateral system with funding from the Gates
Foundation.Ó
Funding: the TreatyÕs Achilles Heel
Financial contributions to the treatyÕs
benefit-sharing fund have been a worry since the coming into force of the
treaty in June 2004, with for the moment financial contributions only coming
from governments and not through the benefit-sharing mechanism. Indonesia
announced the first developing country contribution to the benefit sharing
fund, with a US$100,000 contribution, and called other countries to follow
suit, according to a release.
Countries financially contributing to the
treaty fund are Australia, Canada, Indonesia, Ireland, Italy, Norway, Spain,
and Switzerland. International organisations also have committed resources to
the fund, Bhatti told Intellectual Property Watch. The fund is now
funding projects in 11 developing countries.
The International Seed Federation (ISF),
representing the seed industry associations at the international level, which told
Intellectual Property Watch it has attended every meeting concerning the
treaty during its negotiation and after its adoption, said it welcomed the
resolution of the Governing Body in Bali on compliance procedures and Òhoped it
would lead to a greater implementation of the treaty by its contracting
parties,Ó Anke van den Hurk, the ISF representative at the Governing Body said
that Òeven with the use of molecular techniques, breeding a new variety could
take an average of 8-12 years.Ó
She also said that Òmany new varieties were
protected using plant breeders rights which allowed them to be used by others
without restriction for further research and breeding.Ó This is an important
form of benefit sharing recognised by the treaty, she said.
Nonetheless, the industry is Òlooking at
innovative approaches to implement the treaty, including the most effective
involvement in enhancing the benefit sharing fund projects,Ó she said.
La Via Campesina said in its closing remarks
that Òthe financial mechanisms and funding strategies under the treaty must not
be attached to patents and plant breedersÕ rights,Ó and said the
benefit-sharing mechanism had loopholes exempting industrial plant breeders
from paying, while only delivering varieties protectedÓ by IP rights.
Related Articles:
- International Seed Treaty Hears Concerns Of
Corporate Concentration, DNA Patenting
- New Draft Biodiversity Treaty Text Shows Much
Work Remains; Co-Chairs Hopeful
- Biodiversity Benefit-Sharing Treaty
Negotiators Tackle New Text As Clock Ticks
http://www.seedquest.com/news.php?type=news&id_article=15769&id_region=&id_category=&id_crop=
Source: Intellectual Property Watch via
SeedQuest.com
(Return to Contents)
1.18 Plant breeders say
they have got a new weapon in the war against the illegal use of seeds.
The New Zealand Plant Breeding and Research
Association says the new DNA technology can clearly identify seed lines and
determine their true ownership.
Chairperson John Caradus says plant
breeders are losing millions of dollars a year from having their seeds ripped
off and unlawfully sold.
Mr Cardus says growers who illegally
produce proprietary seeds should not be allowed to cheat plant breeders by not
paying them royalties.
The DNA technology is available to use now
and seed owners will begin testing on a wide range of rye grasses currently on
the market, he says.
Copyright © 2011, Radio New Zealand
http://www.radionz.co.nz/news/rural/71743/dna-latest-weapon-against-illegal-use-of-seeds
Source: SeedQuest.com
(Return to Contents)
1.19 Two Cents: The GMO Debate
March 2, 2011
By Sun Staff
The Sun recently
published a series of opinion pieces debating the pros and cons of genetically
modified organisms. In the interest of fostering further dialogue on the issue,
The Sun solicited the opinions of several knowledgeable professors on the
topic.The Sun recently published a series of opinion pieces debating the
pros and cons of genetically modified organisms. In the interest of fostering
further dialogue on the issue, The Sun solicited the opinions of several
knowledgeable professors on the topic — in what will be the first in a
series of debates on a host of controversial matters. The aim is to present a
sampling of views, which in no way will be entirely comprehensive, but will
hopefully allow readers to learn about different topics from a variety of
perspectives and disciplines.
What are genetically
modified foods?
ÒMuch of the form and
function of a plant is encoded by the DNA in its cells. When you eat either a
genetically modified plant or an organic one, you are also eating its DNA.
Knowing the code of a specific gene in a plant, or the code of a plant's entire
genome, allows us to observe and understand this source of variation in plant
form and function. Two common types of DNA variations are often detected.
First, differences in the code for a gene arise due to mutations in the
DNA resulting in alleles or different forms of a gene. The second
is diversity in which alleles are strung together to comprise the plant's
genome and brought together by pollination of the parent(s). Transgenic or
genetically modified plants (G.M.O.s) contain a specifically targeted change in
a gene or an insertion of an entirely new gene into a genome.Ó
–– Prof.
Mazourek, plant breeding and genetics
Lack of FDA Regulation
When on sabbatical in
Washington, D.C. in 2002, Prof. David Pelletier, nutritional sciences, explored
the scientific and legal basis for the U.S. Food and Drug AdministrationÕs
regulations on genetically engineered food. Two categories exist for food
regulation: food additive and food adulteration.
As described by
Pelletier, the food additive category is more preventive in orientation and
requires publicly available testing, documentation and approval before a food
goes to market, while the food adulteration clause allows the FDA to respond to
unexpected events that happen at some point before and after a food goes to
market. From a strictly legal perspective, the FDA chose to give genetically
engineered foods (as a class) the presumption of being Generally Regarded as
Safe (GRAS), and thereby subject only to the adulteration clause.The dilemma
is, G.E. foods do meet the legal definition of a food that needs to be
regulated under the food additive clause, but in 1992 (and to this day) we do
not have adequate tests for producers to assess the safety of the varied
unintended compositional changes that can occur in G.E. foods.
ÒThe pro-G.E.
scientists typically give the example, Ôpicture a string of yellow beads
representing a strand of DNA in the cells of a food and having one bead
replaced with a red one. This bead will produce the intended new protein. It
only changes one thing in the food.Õ However, we now know that the insertion of
one gene can disrupts the functioning of dozens or even hundreds of other genes
throughout the genome. ItÕs not beads on a string, but more like a spider web,
if you pull on one part, it affects other parts.Ó
ÒNone of this means
G.E. foods are not safe –– it means we donÕt have good methods for
testing them. It also needs to be recognized that the FDA does not require
foods from other technologies to undergo such testing.Ó Interestingly,
PelletierÕs research documented that from 1994-2004, 21,936 USDA research
projects were funded in all areas of food research, but only 19 of these had
the keywords of Òplants, biotechnology and allergens,Ó and most of these were
devoted to detecting or reducing the risks from known allergens.
To date, no such
research initiative has been launched. Another problem is that there is no
requirement that G.E. foods be labeled, so it is not possible to do
epidemiological studies to see if there are any adverse consequences of consuming
G.E. foods. Most disturbing to Pelletier is the way in which the policy was
developed. He said the FDA did not request input on its draft policy statement
from an expert committee of the National Academy of Sciences, nor did it
consult any of its advisory committees. ÒMy beef isnÕt with genetically
engineered food; itÕs with the process FDA used to formulate its policy, which
was an inside job from beginning to end and even disregarded the concerns of
senior FDA scientists.Ó
––
Interview with Prof. David Pelletier, nutritional sciences
G.M.O.s and Feeding
the World
ÒThe worldÕs
population is currently about 7 billion and it expected to grow to 9 billion by
2050. Today, according to the Food and Agriculture Organization of the
United Nations, there are more than 900 million undernourished people in the
world. The FAO defines undernourished as lacking sufficient calories to meet
energy requirements. In addition, more than 2 billion people, mostly
children and women, are iron deficient and an estimated 6,000 children die
every day from vitamin A malnutrition.
One strategy for
addressing the problem of micronutrient malnutrition (vitamin and mineral
deficiency) is biofortification of staple food crops such as rice, wheat,
maize, sweet potatoes and beans. Biofortification is the use of
biotechnology to enhance the content and/or bioavailability of vitamins and
minerals in foods. One well-known and promising example of a biofortifed
food is golden rice. Golden rice was developed using genetic engineering to
program rice plants to produce beta-carotene in the rice kernels.
(Beta-carotene is converted to vitamin A in the body.) This means that
conventional plant breeding cannot be used to increase beta carotene in rice
kernels, leaving genetic engineering as the only alternative for breeding
biofortified rice. Rice provides as much as 80 percent of the
calories in the diets of the poor in many areas of the world and vitamin A
deficiency is often prevalent in rice eating areas.
I donÕt believe that
genetic engineering alone can save the world from hunger and malnutrition but I
do think it is one of many strategies and technologies that we must pursue if
we are to have any hope of feeding the 9 billion people who will inhabit out
planet by 2050. All technologies we develop carry risks but I believe we
must be willing to take some risks because the alternative is the status quo
with millions of people suffering terribly from hunger and malnutrition.Ó
–– Prof.
Dennis Miller, food science
Public Perception of
G.M.O.s Abroad
Prof. Ronald Herring,
government, has done extensive research on genetically modified organisms and
their use and impacts in India. In 2008, Herring wrote an op-ed for
The Hindu regarding the misconceptions of the effects of G.M.O.s on Indian
farmers. Herring writes, ÒThere is a great puzzle here. If disastrous in 40
countries, why does the technology spread so rapidly across nations and farms?
Recombinant DNA technologies represent perhaps the most rapid adoption of any
agricultural technology in history. Are farmers irrational, ignorant, duped?
The subaltern famously cannot speak, but can she not count either?Ó
Herring continued,
ÒThere is then no puzzle of farmers adopting disastrous technologies: the
disasters exist entirely in the imaginary of advocacy networks that have
interests in disasters. The acceptance of molecular breeding technologies is
rooted in precisely the agency and rationality of Indian farmers denied in
global narratives of G.M.O. opponents. Neither duped nor innumerate, cotton
farmers face extreme challenges — from climate change to globally rigged
markets — but they do know what works in their fields.Ó
Prof. Herring teaches
CSS 4100: The G.M.O. Debate: Science and Society, along with Profs. Peter Hobbs
and Janice Thies, crop and soil sciences. Though the science behind genetically
modified foods is not Herring's academic focus, he shared his thoughts on the
subject. When asked about the safety of G.MO.s, Herring responded, ÒThere are
studies that show that the transcriptomic errors introduced by other means of
plant breeding considered ÔconventionalÕ are greater than those made by
recombinant DNA breeding. The question is whether there is more or less risk in
genetically engineered plants as opposed to breeding techniques we think of as
conventional, that have been normalized. Most important is mutagenic plants,
which are bred by taking a traditional cultivar and inducing mutations by
radiation or chemical agents called mutagens. HereÕs the critical point:
only recombinant DNA plants –– where genes are spliced together
–– are considered ÔG.M.O.sÕ and subjected to special
scrutiny."
––
Interview with Prof. Ronald Herring, government
Pesticides, Organics,
and Comparative Breeding
Prof. Elizabeth Earle,
plant breeding and genetics, challenged the assertion of the Feb. 15 opinion
piece ÒRejecting Genetically Modified FoodÓ that G.M.O. crops can cause
resistance to pesticides.
ÒOther genetically
modified foods are made to resist insect attack, like BT crops, reducing the
use of pesticides. Therefore, they cause the introduction of fewer toxic
chemicals in the environment. Consumers ought to be pleased about that.Ó
ÒOne of the big
arguments about G.M. crops is the problem it creates for organic growers. Organic
growers decided themselves that being organic would mean having only a small
percentage of their crops as G.M. There are G.M. crops that could be considered
favorable for the environment.Ó
Finally, food safety
remains a contentious aspect of using G.M. plants. ÒPeople have been eating
G.M. foods in this country since 1996,Ó Earle said. ÒEverything I've seen on
food safety points to the safety of G.M. plants.Ó
Earle cited a survey
recently published in Plant Physiology that examined 44 microarray studies
comparing genetically engineered (G.E.) crops to non-G.E. crops.
The authors concluded
that there are fewer changes in the plant genome –– in the overall
expression of genes and proteins –– of G.E. crops compared to
changes caused by traditional breeding or environmental conditions, like
drought. ÒThis indicates that the overall changes to the plant genome by G.M.
are smaller than the natural variation caused by traditional breeding.Ó
––Interview
with Prof. Elizabeth Earle plant breeding and genetics
http://www.cornellsun.com/section/science/content/2011/03/02/two-cents-gmo-debate
Source: SeedQuest.com
(Return to Contents)
1.20 Mexico
oks pilot field of genetically modified corn
MEXICO
CITY, March 8 | Tue Mar 8, 2011 7:15pm EST
(Reuters) - Mexico on Tuesday
approved the first pilot program to plant genetically modified corn, a
sensitive topic in the country that touts itself as the birthplace of corn and
where small farmers worry the high-tech grain may contaminate native varieties.
The Agriculture Ministry granted
a permit to global biotech seed maker Monsanto (MON.N) to
plant no more than 2.47 acres (1 hectare) with genetically modified corn in the
northern state of Tamaulipas.
Large commercial farmers in the
north say GM corn will help them compete with imports from the United States
where the bulk of corn is genetically engineered. GM corn can be higher
yielding and more disease resistant.
But small, subsistence farmers in
southern Mexico worry the biotech crops will threaten native varieties like
red, blue and multicolored corn.
Corn, first planted in Mexico as
many as 9,000 years ago, was worshiped as a deity and later spread by Spanish
conquerors to the rest of the world.
Mexico imported some 7.2 million
tonnes of U.S. yellow corn last year for animal feed and produces mostly white
corn to make corn tortillas, the country's staple food.
"It is necessary to advance
the use of biotechnology to reduce imports and promote national
production," the ministry statement said.
A pilot program is allowed after
an experimental phase of planting in a smaller field has been approved as safe
by government inspectors, the ministry said in a statement.
Three petitions to expand
experimental GM planting in the state of Sinaloa into larger pilot projects
were rejected after failing to fulfill regulatory requirements, the ministry
said.
The government says it has
received 121 requests for permits since it began allowing GM corn experiments
in 2009.
Currently there are around 170
acres (70 hectares) planted with GM corn in small experimental fields the
northern corn growing states of Sinaloa, Sonora, Chihuahua, Tamaulipas,
Coahuila and Durango, the ministry said.
Agriculture officials insist the
experimental planting is taking place only in areas where native corn is not
common. (Additional reporting by Adriana Barrera; Editing by David Gregorio)
http://www.reuters.com/article/2011/03/09/mexico-crops-idUSN0820236920110309
Source: SeedQuest.com
(Return to Contents)
1.21 Details of EU proposals on GM crops
March 14, 2011
(Reuters) - EU environment ministers held
talks on Monday on proposals to let member states decide individually whether
or not to ban the cultivation of genetically modified (GM) crops, in a bid to
unblock a paralysis in EU GM approvals.
The proposals include an amendment to EU
rules on GM cultivation that would allow governments to ban cultivation of
approved GM crops on social or economic grounds, such as public opposition or
to safeguard organic farming.
Below are extracts from the proposals,
which must now be approved by a majority of EU governments and lawmakers in
order to become law:
PROPOSED LEGAL CHANGE TO EU RULES ON GM
CROP CULTIVATION
* "The current EU legal framework
fully harmonizes cultivation of GMOs. Experience however has shown that cultivation
of GMOs is an issue which is more thoroughly addressed by Member States."
* "The proposal amends Directive
2001/18/EC by introducing a new article which allows member states to restrict
or prohibit the cultivation of authorized GMOs in part or all of their
territories."
* "The freedom which member states
will obtain will only concern the act of GMO cultivation, but not the placing
on the market and import of authorized GM seeds which must continue
unimpeded."
* "The proposal stipulates that member
states cannot invoke protection of health and environment to justify a national
ban of cultivation of GMOs."
* "The measures taken by the member
states have to be in conformity with the Treaty on the European Union ... in
particular as regards the principle of non-discrimination between national and
non-national products and the provisions on quantitative restrictions of trade
between member states."
* "They should finally be consistent
with the international obligations of the EU, and in particular with the one
established under the World Trade Organization."
(Compiled by the Brussels newsroom)
http://www.reuters.com/article/2011/03/14/us-holdeu-gmo-details-idUSTRE72D66520110314
Source: SeedQuest.com
(Return to Contents)
1.22 Long week ahead for
WIPO experts considering treaty on IP and genetic resources
Geneva, Switzerland
February 28, 2011
By Catherine Saez, Intellectual Property
Watch
Having successfully advanced discussions
toward treaties on the protection of folklore and traditional knowledge,
country experts this week are meeting at the World Intellectual Property
Organization to discuss the protection of genetic resources. But this time, it
might prove trickier.
The positive results of the two previous
working groups have established momentum toward producing the basis for an
international treaty text. However, experts this week might face a tougher task
with multiple working documents from which to work and the objectives might
have to be humbler.
The Third Intersessional Working Group (IWG 3) of the WIPO Intergovernmental Committee on
Intellectual Property and Genetic Resources, Traditional Knowledge and Folklore
(IGC), gathering country experts, is meeting from 28 February – 4 March.
The aim is to try to produce a text that would be a basis for negotiations at
the 18th session of the IGC from 9-13 May.
The IGC was established by the WIPO General
Assembly in October 2000 with the objective of Òreaching agreement on a text of
an international legal instrument (or instruments) which will ensure the
effective protectionÓ of traditional knowledge, traditional cultural
expressions and genetic resources, according to WIPO.
In order to help the process, the IGC
established three expert working groups to meet between IGC sessions to address
the three issues separately. The groups were tasked with providing expert
advice and discussions on each subject and provide draft text as a basis for
negotiations at the May IGC.
The First Intersessional Working Group (IWG
1) of the IGC worked on traditional cultural expressions in July and produced a
text that will be presented to the next IGC (IPW,
WIPO, 26 July 2010). The Second
Intersessional Working Group (IWG 2) addressed traditional knowledge from 21-25
February and also produced a set of draft articles to be brought forward to the
ICG (IPW,
WIPO, 25 February 2011).
Key Issues this Week
A key issue of this weekÕs discussions is
the mandatory disclosure of genetic resources in patent applications, according
to sources. Another key point is the inclusion of derivatives in the discussions
they said. Derivatives are referring to plant extracts, or metabolites (active
compounds in plants or animals).
Both of those issues were keenly discussed
in October during the negotiations leading to the Nagoya Protocol on Access to Genetic Resources and
the Fair and Equitable Sharing of Benefits Arising from their Utilization to
the Convention on Biological Diversity
[pdf].
The experts meeting this week have a heavy load
of working documents compiled by WIPO to go through, including proposals kept
on the table by countries at the 17th IGC meeting in December (IPW,
WIPO, 11 December 2010), such as
the draft objectives and principles [pdf] proposed by Australia, Canada, New Zealand,
Norway and the United States, a submission
[pdf] by the African Group on genetic resources and future work, a proposal
[pdf] by Switzerland on the declaration of the source of genetic resources and
traditional knowledge in patent applications, and a document
[pdf] submitted by the European Union also on the source of genetic resources
and associated traditional knowledge in patent applications.
JosŽ L—pez de Le—n, second secretary of the
Geneva Mexican permanent mission, was elected chair of IWG 3, and laid out its
roadmap this morning. Today and tomorrow should be devoted to discussing
objectives and principles with the aim of shortening the deadline if possible,
he told Intellectual Property Watch.
The following days will be devoted to
developing a matrix of different options, see where they fit with the
objectives and principles discussed before, and define priorities. It is
important to keep in mind that the discussions have to be kept at a technical
level, he said.
On the topic of genetic resources,
countries can be broadly defined by two extreme positions and the aim of this
week is to deliver two options to which countries can relate to so that the IGC
can start negotiating on that basis, he added.
According to participants, indigenous
peoples vigorously opposed the mention in the objectives and principles of the
sovereign rights of states over genetic resources, as that goes against the
right to self-determination and the sovereign rights of indigenous peoples as
stated in different United Nations conventions and covenants, and in particular
their rights over their genetic resources. They also said that the human rights
dimensions should be taken into account in the efforts to establish an
international instrument.
Several countries such as Bolivia and
Venezuela also said they wished to have national sovereign rights on the scope
of patentability, in particular on life forms, according to sources.
The Nagoya Protocol, whose aim is to
prevent unlawful appropriation of genetic resources, was adopted on 29 October (IPW,
Biodiversity/Genetic Resources/Biotech, 29 October 2010). It includes languages on prior informed consent
of indigenous and local communities (Article 6). The protocol was characterised
by many as a good starting point but containing softening language like Òas
appropriateÓ and Òwhere applicable,Ó with much left to interpretation and to
national level implementation.
A developed country source told Intellectual
Property Watch that disclosure of patent applications is an intellectual
property issue and as such should remain under WIPO competence. Another
developed country source said that the discussions on objectives and principles
would be key to further progress.
On 25 February, Mexico became the fifth
country to sign the Nagoya Protocol, according to a CBD press release [pdf]. The instrument will take effect at the 50th ratification by
countries.
Side Events this Week
On Tuesday, South Africa will hold a side
event to the IWG 3 on ÒThe National Recordal System as multimedia platform for
the recording, documentation and dissemination of indigenous knowledge in South
Africa.Ó On Thursday, the International Centre For Trade and Sustainable
Development and the United Nations Conference on Trade And Development (UNCTAD)
will co-organise a panel discussion on The Nagoya Protocol on Access and
Benefit Sharing and its impact on other multilateral debates on intellectual
property and biodiversity.
More news from: Intellectual Property Watch
Website: http://www.ip-watch.org
http://www.seedquest.com/news.php?type=news&id_article=15056&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.23 UN-backed treaty meeting seeks to boost
conservation of worldÕs plant varieties
The Multilateral System forms a gene pool
of over 1.3 million unique crop samples
14 March 2011 – The governing body of
a United Nations-backed treaty considered vital for the preservation and use of
the worldÕs threatened plant genetic resources met in Bali, Indonesia, today to
map out a future course in the face of food insecurity and climate change.
The International Treaty on Plant Genetic
Resources for Food and Agriculture, adopted at the Conference of the UN Food
and Agriculture Organization (FAO) in 2001 and backed by 127 members, creates a
multilateral system through which member countries share the genetic material
of 64 of the most important crops for food security – crops that account
for more than 80 per cent of our plant-sourced food.
No country is self-sufficient in plant
genetic resources, and international cooperation and exchange of genetic
resources are thus pivotal for food security. Through the Treaty, countries
have agreed to establish a multilateral system to facilitate access to key
plant genetic resources for food and agriculture, and to share the benefits
derived from that access in a fair and equitable way.
ÒThe more efficiently crops are protected
under the Treaty, the better humankind will be able to conserve and share crop
genetic resources to meet the enormous food security challenges of the present
and future generations,Ó Treaty Secretary Shakeel Bhatti said.
The five-day meeting will consider the full
spectrum of plant genetic diversity and the role it can play in providing or
cross-breeding varieties that can meet ever changing environmental conditions
to provide food for the worldÕs surging multi-billion population.
Today, the multilateral system forms a gene
pool of over 1.3 million unique crop samples. The Treaty also has a benefit
sharing fund by which farmers are supported in the conservation and use of
genetic diversity on their own farms.
FAO estimates that 75 per cent of crop
diversity was lost between 1900 and 2000. A recent study predicted that as much
as 22 per cent of the wild relatives of important food crops such as peanut,
potato and beans could disappear by 2055 because of a changing climate.
The Treaty recognizes the enormous contribution
that farmers and their communities have made and continue to make to the
conservation and development of plant genetic resources. This is the basis for
farmersÕ rights, which include the protection of traditional knowledge, and the
right to participate equitably in benefit-sharing and in national
decision-making about plant genetic resources. It gives governments the
responsibility for implementing these rights.
Agriculture ministers and senior officials
from more than 100 countries gathered in Bali last week in preparation for this
weekÕs meeting and urged those nations who have not yet signed the treaty to do
so as soon as possible.
They recognized that climate change poses a
serious risk to plant genetic resources that are essential as a raw material
for crop genetic improvement, whether by farmer selection, classical plant
breeding or modern biotechnologies, as well as in adapting to unpredictable
environmental changes.
Most of the worldÕs food comes from four
main crops – rice, wheat, maize and potatoes, but local crops, not among
these, are a major food source for hundreds of millions of people and have
potential to provide nutrition to countless others. The Treaty helps maximize
the use and breeding of all crops and promotes development and maintenance of
diverse farming systems.
http://www.un.org/apps/news/story.asp?NewsID=37759&Cr=&Cr1=
Source:
SeedQuest.com
(Return to Contents)
1.24 Rebuild small seed
enterprises - Farmers' seed ventures key to food security in developing
countries
Rome, Italy
1 March 2011
Small seed enterprises are the best way of
ensuring the availability and quality of non-hybrid seeds for food and feed
crops in developing countries, said FAO in a policy guide published today.
According to the World Bank, up to 50
percent of crop yield increases have come from improved seeds, while farmers'
access to quality seeds is a key factor for better food and nutrition in poor
countries.
In recent years, however, a large number
governments in the developing world reduced public investment in the seed
sector, the expectation being that the private sector would fill the gap.
In many places, especially Africa, this has
not happened as medium and large seed companies tend to concentrate on
producing hybrid seed for high value crops grown by larger farmers and market
them in more fertile, wealthier areas.
Sharing not enough
As a result, only about 30 percent of
smallholder farmers in developing countries use seed of improved varieties of
variable quality — in Africa the percentage is smaller still.
Hybrid seeds provide better yields and
disease resistance but cannot be saved by farmers for the next planting, as the
hybrid plant seeds do not reliably produce true copies.
The majority of poor smallholder farmers
growing food security crops such as sorghum, millet and cassava rely on self or
open-pollinated seeds or crops that are propagated through dividing bulbs, or
taking cuttings stored from previous harvests and grafting them.
However, they do not always have access to
new varieties that can help them increase production using the same amount of
inputs.
"It doesnÕt costs a lot comparatively
to set up a seed enterprise, especially when it involves local farmers'
organizations, but as case studies in the policy guide from three continents
have shown, such enterprises can be highly effective in improving food
output," said Shivaji Pandey, Director of FAOÕs Plant Production and
Protection Division.
Brazil, India, Cote DÕIvoire
The policy guide, entitled ÒPromoting
the Growth and Development of Smallholder Seed Enterprises for Food Security
CropsÓ, is based on case studies from Brazil, India and C™te d'Ivoire,
the results of which have been published separately by FAO.
In all three cases, a favorable policy
environment was found to be a key requirement to the successful development of
smallholder seed enterprises.
Examples include an efficient quality
control and certification system, private sector support, flexible legislation
and the legal recognition of the rights of farmers to save, exchange and sell
seeds of commercial varieties.
Private sector support
Support for privatization and
commercialization of agricultural services and the support of plant breeder
rights are also imperative. Other factors that can help farmers set up
small-scale seed enterprises include reduced tariffs for the import of
seed-cleaning and other equipment, key to establishing a seed industry, as
adopted by the government of C™te d'Ivoire.
Credit must also be available to seed
producers; lack of credit was seen as a major hindrance to seed enterprise
development and seed producers should be given assistance to run marketing and
communications campaigns including the use of rural radio networks to advertise
improved varieties to farmers.
Marketing help
"Sometimes the seed is there but
farmersÕ organizations need assistance and guidance in marketing it to other
farmers," said Pandey. Many small-scale seed enterprises have been
developed with the support of donors or NGOs but this can lead to aid
dependency if both technical and entrepreneurial capacities are not developed
for self-reliance, the FAO document warns.
It is hoped that legislation governing
seeds for the whole of Africa will eventually be harmonized to make it easier
for new varieties to cross borders. This is of particular importance because of
climate change which is increasing the need for more resilient varieties.
Therefore, new hybrid seed must be
purchased for each planting. The seed of self-pollinated crops (wheat and
beans, for example) can be saved by farmers for next planting.
Generally speaking, seed purchased from
qualified and reliable seed producers is better in purity, germination and
overall quality regardless of whether is hybrid or non-hybrid seed.
http://www.seedquest.com/news.php?type=news&id_article=15071&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.25 Genebanks could be
storing the wrong seeds - Dutch study investigates the authenticity of heirloom
cultivars stored at genebanks
Madison, Wisconsin, USA
March 8, 2011
Loss of diversity in crops has prompted
many in the global agricultural community to store seeds in genebanks. The
seeds can then be used for breeding new cultivars, research, or for crop
variance. Crop breeds that have all but disappeared from agriculture are stored
and available to the general public.
However, genebanks are modern institutions
that were established after many of the old cultivars were no longer in use.
The seeds stored for old cultivars were collected from numerous sources, many
with little information concerning the seed. Therefore, genebanks could be
storing seeds that do not genuinely represent the original cultivar.
Scientists at the NetherlandsÕ Center for
Genetic Resources have examined the extent of the problem of non-authenticity
of old cultivars in genebank collections. Using a large lettuce collection from
a Dutch genebank, researchers sampled and compared DNA from seeds presumed to
be identical because they bared the same cultivar name. The results of DNA
testing indicated that many supposedly identical seeds did not match and levels
of authenticity were lower than originally presumed, especially in older
cultivars. In addition, even recently stored cultivars showed a 10% lack of
authenticity.
Mark van de Wouw, the author of the study,
expressed his surprise by saying, ÒFrom my experiences with other genebanks I
did suspect there might be a problem with the authenticity of the seeds that
was sent out to users, but I did not realize the problem to be this large.
Although current procedures in the genebank avoid to a large extent that new
mistakes are being made, the level of mislabeling in the past has apparently
been high. It is obvious that systematized efforts need to be made to check the
authenticity of the heirloom cultivars in genebank collections.Ó
The full study is published in the
March/April 2011 issue of Crop Science.
The full article is available for no charge
for 30 days following the date of this summary. View the abstract at https://www.crops.org/publications/cs/abstracts/51/2/736.
http://www.seedquest.com/news.php?type=news&id_article=15252&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.26 Agriculture
ministers and senior officials from more than 100 countries commit to review
the world crop gene pool
Bali meeting sees climate benefits of genetic diversity
in edible plants
Bali, Indonesia
11 March 2011
Agriculture ministers and senior officials
from more than 100 countries have committed to review the global crop gene pool
of the International Treaty on Genetic Resources for Food and Agriculture and
urged those countries who have not signed the farming biodiversity treaty to do
so as soon as possible.
The ministers paved the way forward on the
eve of a meeting of the Treaty's Governing Body in Bali, Indonesia on March
14-18, adopting a lengthy declaration designed to steer the Treaty's future
course to face food insecurity and climate change.
The Treaty, which came into force in 2004,
creates a multilateral system through which member countries share the genetic
material of 64 of the most important crops for food security - crops that
account for over 80 percent of our plant-sourced food.
127 countries have already signed the
Treaty with more signatures in the pipeline.
More tomatoes and more benefits?
Whilst wheat, rice and potatoes are
included in the Treaty's gene pool, tomatoes were excluded ten years ago during
the negotiations that lead to its adoption.
"The more efficiently crops are
protected under the Treaty, the better humankind will be able to conserve and
share crop genetic resources to meet the enormous food security challenges of
the present and future generations," said Shakeel Bhatti, Secretary of the
Treaty.
"Indonesia is a mega-biodiverse
country and has always played a lead role in the Treaty and today it did so
again showing that agriculture and environment can and must go along
together," said Bhatti.
Today, the Multilateral System forms a gene
pool of over 1.3 million unique crop samples. The Treaty has also has a benefit
sharing fund by which farmers are supported in the conservation and use of
genetic diversity on their own farms.
Climate dangers
Spain, Italy and Norway and Australia are
the major donors to the Benefit-sharing Fund (BSF) set up by the Treaty to
support poor farmers in developing countries in adapting their traditional
crops to the changing environment.
In their declaration, ministers and senior
officials also recognized that climate change poses a serious risk plant
genetic resources that are essential" as a raw material for crop genetic
improvement -whether by means of farmer selection, classical plant breeding or
modern biotechnologies-" and also "in the development of new market
opportunities, and in adapting to unpredictable environmental changes."
It is expected that in the course of this
meeting countries would announce new investments to extend the number of
activities and conservation projects supported worldwide as well as the number
of people that benefit from it.
http://www.seedquest.com/news.php?type=news&id_article=15319&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.27 Study shows how
plants sort and eliminate genes over millennia
West Lafayette, Indiana, USA
March 9, 2011
Hybrid plants with multiple genome copies
show evidence of preferential treatment of the genes from one ancient parent
over the genes of the other parent, even to the point where some of the
unfavored genes eventually are deleted.
Brian Dilkes, an assistant professor of
genetics at Purdue University, worked with a team of scientists at the
University of California Davis and University of Southern California to study
the genome of Arabidopsis suecica, a hybrid species with four chromosome sets
formed tens of thousands of years ago from a cross between Arabidopsis arenosa
and Arabidopsis thaliana, a plant commonly used in laboratories for genetic
research. Dilkes said the findings, published in the journal Genome Biology and
featured as an editor's choice article in the journal Science, give a glimpse
into the evolutionary forces and ultimate fates of genes contributed by the two
parents to a hybrid
"There often is no visible signature
of these genes when we look at the plants with a microscope, but we can still
observe those genes in the genome sequence," Dilkes said. "Moreover,
the ability to make crosses between Arabidopsis thaliana and Arabidopsis arenosa
gives us the opportunity to compare laboratory-derived plants that were
generated yesterday with naturally occurring species from the wild and compare
the two kinds of species hybrids. This is essentially allowing us an
opportunity to 'replay the evolutionary tape,' in the words of Stephen J.
Gould."
The researchers compared the genomes and
gene expression among Arabidopsis suecica plants that have evolved over tens of
thousands of years to similar species of hybrids made in the lab from fresh
crosses.
When the contribution of genes from each
parent was compared, they were not equal. One parent's genes were
preferentially expressed at higher levels. In the cases where that happened, it
was three times more likely that the preferentially expressed genes came from
Arabidopsis arenosa.
The team also found that gene pairs that
are co-expressed in similar tissues are preferentially expressed from the same
parent. Even in the rare cases when an Arabidopsis thaliana gene was more
abundantly expressed in the hybrid, co-expressed genes would also be
preferentially expressed from the Arabidopsis thaliana copy.
"Our findings suggest an additional
network dependence, where genes fine-tuned to work together within either
parental species prior to hybridization are more likely to be expressed
together in the hybrid. This, in turn, ensures that these genes acquired from
one parental species are kept together and are not lost in the genome over
time," said Peter Chang, a graduate student at USC and lead author on the
paper. "Plants have had a remarkable ability to adapt to different
conditions throughout Earth's history, and we are just beginning to understand
some of ways this is done."
Previous work has shown that plant genomes
with historical duplications from tens of millions of years ago have lost one
of the two copies in large blocks along the chromosome, consistent with the
preferential loss of one parent's contribution.
Dilkes said the retained genes may have a
role in the plants' fitness but genes that weren't expressed would be deleted
from the genome.
"The genome is moving toward a
two-copy organization, a diploid, by preferentially deleting one parent. When
others have looked at genomes that have ancient duplications they see large
blocks of duplications in which one block has a large number of genes and the
other has a sparse gene content," Dilkes said. "Perhaps a cause of
this pattern in the organization of genomes is preferential expression, and,
all other things being equal, the gene that is more abundantly expressed will
carry a greater proportion of the fitness load for any essential
function."
The National Science Foundation funded the
research.
http://www.seedquest.com/news.php?type=news&id_article=15270&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.28 U.S. dairy farmer
finds unusual forage grass
Washington, DC, USA
March 15, 2011
A U.S. Department of Agriculture
(USDA) grass breeder has rediscovered a forage grass that seems just right for
today's intensive rotational grazing.
A farmer's report of an unusual forage
grass led Michael Casler, an Agricultural Research Service (ARS) geneticist at the agency's U.S. Dairy Forage Research Center in Madison, Wis., to identify the grass as meadow
fescue, Schedonorus pratensis. Meadow fescue (photo) has been long
forgotten, although it was popular after being introduced about 50 to 60 years
before tall fescue.
ARS is USDA's principal intramural
scientific research agency.
Casler has developed a new variety of
meadow fescue called Hidden Valley, and its seed is being grown for future
release.
Non-toxic fungi called endophytes live
inside meadow fescue, helping it survive heat, drought and pests. Unlike the
toxic endophytes that inhabit many commercial varieties of tall fescue and
ryegrass, meadow fescue does not poison livestock.
Charles Opitz found the grass growing in
the deep shade of a remnant oak savannah on his dairy farm near Mineral Point,
Wis. He reported that the cows love it and produce more milk when they eat it.
Casler used DNA markers to identify Opitz's find.
Meadow fescue is very winter-hardy and
persistent, having survived decades of farming. It emerged from oak savannah
refuges to dominate many pastures in the Midwest's driftless region, named for
its lack of glacial drift, the material left behind by retreating continental
glaciers.
Casler and his colleagues have since found
the plant on more than 300 farms in the driftless region of Wisconsin, Iowa and
Minnesota. Geoffrey Brink, an ARS agronomist working with Casler, discovered that meadow fescue
is 4 to 7 percent more digestible than other cool-season grasses dominant in
the United States.
In another study, meadow fescue had a
nutritional forage quality advantage over tall fescue and orchardgrass that may
compensate for its slightly lower annual yield further north, as reported in
the Agronomy Journal. Also, the yield gap begins to close with the
frequent harvesting involved in intensive grazing.
Read more
about the research in the March 2011issue of Agricultural Research magazine.
Photo by Michael Casler.
http://www.seedquest.com/news.php?type=news&id_article=15391&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.29 The cult of heirloomism
Farmers and home gardeners embrace old seeds—
but are they better?
DREW KELLY/New York Times
CRAIG DILGER/New York...
As gardeners stock up on heirloom seeds for
spring, Rob Johnston, the chairman of JohnnyÕs Selected Seeds in Winslow,
Maine, would like to suggest an accessory. Why not buckle up in a 1936
Oldsmobile coupe?
OK, so it doesnÕt have seatbelts. But the
swoop of the fenders resembles Joan CrawfordÕs eyebrows. Better yet, the rest
of the OldsmobileÕs curves are all Lana Turner.
And the technology! Where else can todayÕs
driver find such innovations as knee-action wheels and a solid steel Òturret
topÓ?
Even with all a Õ36 Olds has going for it,
Johnston said, ÒIÕm not sure how big of a market there would beÓ for
75-year-old cars. ÒIt would just be a sentimental business.Ó
So to return to JohnstonÕs own business,
vegetable seeds, why is the back yard gardener buying so many 1936-era
heirlooms?
Johnston, it should be noted, is a fan of
heirlooms, which in the broadest sense, are old varieties of open pollinated
seeds that will grow the same plant again.
He argues that his typical customers
— small market farmers and avid home gardeners — have better
choices. Modern seeds, generally hybrid crosses, produce a Òmore vigorous
plant, better resistance to diseases.Ó
Source: Xinhua via Chinese Academy of
Sciences
And hereÕs the heirloom heresy: They often
taste better, too.
Heritage seed buyers could rebut some or
all of those claims — and they do. But agronomy, in a sense, is the least
of it.
Seventeen years ago, in the New York Times,
writer Michael Pollan spelled out the economic and environmental hazards of
hybrid seeds in an article that came with a fright-movie title, The Seed
Conspiracy.
In the years since, the superiority of
certain types of seed has grown into a kind of orthodoxy among right-thinking
gardeners. The philosophy could be called heirloomism. According to some plant
breeders and seed sellers, it propagated a reactionary — and sometimes
confused — argument about food, farming and science.
The debate may seem abstract. But one
question it raises for the gardener is plain as dirt: What kind of seeds will
succeed?
One thing nobody would dispute is that
business is booming in heirloom seeds. Seed Savers Exchange in Iowa, a leading
source of heirlooms, has seen sales Òincreasing dramatically,Ó said the
executive director, John Torgrimson.
Sales shot up 100 per cent in 2008 at Baker
Creek Heirloom Seeds, a Missouri garden company that stocks 1,200 vegetable
varieties, and the last two years have brought 20 per cent annual growth, said
the companyÕs owner, Jere Gettle.
According to a survey by the National
Gardening Association, one in five American households with a yard or garden
reports an interest in heirloom fruits, berries and vegetables. But Gettle, 30,
contends his generation cares even more about heirlooms.
ÒNew gardeners, younger gardeners —
90 per cent are interested in heirlooms and traditional varieties,Ó Gettle
said.
The appeal is plain to see, not just to
taste. The Baker Creek catalogue can deliver as much wonderment as the
Westminster Kennel Club Dog Show. How can common vegetables come in so many
comical shapes and unlikely colours?
Beyond the aesthetics, Gettle said his
customers espouse Òalmost a total rejection of GMOs,Ó or genetically modified
organisms. Further, they donÕt want Òhybridization in their seed supply. They
want to be independent and be able to save their seeds. They donÕt like the big
boys.Ó
One of the undeniable big boys in garden
seeds is W. Atlee Burpee & Co. The Doylestown, Pa., company is AmericaÕs
largest purveyor of open-pollinated seeds. Chief executive officer George Ball
said heritage seed sales have outpaced the rest of BurpeeÕs seed line so more
varieties have been added.
But this Òthird-generation seed manÓ also
seems to relish acting as a heckler of the heirloom movement. In an op-ed piece
in the Des Moines Register last summer, Ball wrote, ÒToday, greener-than-thou
gardeners crusade for heirloom seeds while unjustly condemning hybrids.
Increasingly, their anti-science credo has hardened into a Luddite fundamentalism.Ó
Ball laughs a bit about the bombast of
phrases like Ògreener than thou.Ó But he sticks by his main claim.
ÒHeirlooms were varieties that were so
unsuccessful they wouldnÕt be sold today,Ó he said. ÒEvery product declines
until itÕs replaced by new heirlooms.Ó
That term, new heirlooms, may seem like an
oxymoron. Yet while heirloom seeds stay stubbornly the same, the heirloom brand
continues to evolve.
One of the first print references to
heirlooms appeared in a 1949 article in the New York Times, according to the
Oxford English Dictionary. That dictionaryÕs definition of ÒheirloomÓ matches
the one used by Seed Savers Exchange: open-pollinated varieties that are more
than 50 years old and have been handed down through generations.
But that classification describes only a
portion of the 13,500 varieties in the groupÕs yearbook. So Torgrimson, 60,
embraces a wider and more useful classification that includes four categories.
First, there are the family legacies, such
as BakeryÕs squash. Emma Adkins, of Van Lear, Ky., took this striped acorn
cultivar from her motherÕs garden and donated it to Seed Savers in 1994.
Perhaps the greatest number of heirloom
seeds come from the second group: old market varieties. A classic example is
the Danvers carrot. The Fedco Seeds catalogue traces this vegetable back to
Massachusetts farmers in 1871.
Third is a Òmodern heirloomÓ such as the
sugar snap pea. Vegetable breeder Calvin Lamborn developed this open-pollinated
favourite for Gallatin Valley Seed Co. in the 1970s.
The origins of the sugar snap, a rogue,
thick-walled pea, lie in TorgrimsonÕs fourth category, Òmystery heirlooms.Ó
These are serendipitous discoveries and field crosses that farmers and
gardeners decide to preserve and plant again.
In the plainest sense, heirlooms are just
old seeds. What has changed is the way we venerate them, said Bill Tracy, 56, a
sweet-corn breeder and professor of agronomy at the University of Wisconsin.
Tracy estimates that, over the decades, he
has grown 75 to 80 per cent of these varieties.
Marketing them as heirlooms, however, is Òa
new concept, a concept of the early 21st century,Ó Tracy said. Plants are
sexually active, mutable things, he explained. They can be adapted to different
climates, soil types and planting and harvest dates.
ÒThe farmer or the gardener has the
opportunity to select the type that is best for their farm,Ó he said. And
Òprevious generations of farmers, our parents or grandparentsÓ did just that.
An open-pollinated seed wasnÕt an item to
be named, treasured and monastically cloistered. For their part, the seed
companies and catalogues, which were then small and regional, collected seeds
from the plants that performed best from year to year.
John Navazio, 56, a Washington State
University seed specialist and senior scientist for the Organic Seed Alliance,
suggests the growers who developed heirloom seeds wouldnÕt be content with them
today.
ÒA 1902 cabbage by Burpee was a perfectly
good cabbage by 1902 standards,Ó Navazio said. ÒBut none of our ancestors ever
viewed these things as done. You never stopped breeding your livestock. You
never stopped selecting your cabbage.Ó
For the discriminating food shopper, the
word ÒheirloomÓ has another meaning. Heirloom vegetables are the delicious
ones. These are the turnips dolled up in magazine photo spreads and honoured by
name on the menus of the better restaurants — even some of the worst
ones.
Torgrimson admits he has dallied with a few
hybrids in the past. But Òyou canÕt beat the tasteÓ of heirlooms, he said. He
recalled what a visitor to Seed SaversÕ Heritage Farm asked last summer after
biting into a gusher of a tomato: ÒWhy does the tomato in the store taste like
a red rubber ball?Ó
Bob Heisey, a 62-year-old tomato-and-pepper
breeder for United Genetics Seeds Co., has heard that question before.
ÒA lot of the complaints,Ó he said, Òare
about supermarket tomatoes that are picked when theyÕre green, and gassed with
ethylene to develop the red colour and then refrigerated to keep them fresh so
that they look marketable when they get to the store.Ó
Heirlooms are not intrinsically more
appetizing than modern hybrids. Heirlooms began as hybrids, after all — a
fortuitous cross of two parents. Modern hybrids, or so-called ÒF-1s,Ó are
usually proprietary to a seed company. But this is still the 19th-century
genetics of Gregor Mendel, not genetic engineering.
Heirlooms grow glorious fruit for many
reasons. One is size. An heirloom tomato is often a big, robust plant. The
central stalk is usually indeterminate: It keeps shooting up after setting
fruit. Ball, of Burpee, recalls a customer telling him about a Brandywine plant
that crept into the house through a second-floor window.
An heirloom tomato will also have a lot of
leaves, in groups of three, Heisey said. All that green surface area translates
into a lot of photosynthesis, which means higher sugar levels, one of many
factors that make for a mythic tomato.
A modern, hybrid tomato, by comparison, is
typically determinate in the way it grows: The stem will stop growing. The
leaves come in pairs. Farmers prefer compact plants with earlier and higher
fruit yields.
But thatÕs not the end of the story. As any
impatient gardener will testify, many of those old tomato plants donÕt like to
be hurried to make fruit. While theyÕre hanging around the yard, the foliage
can pick up a legion of common diseases.
As the stricken plant sheds leaves, it has
less sugar to channel into the fruit.
By comparison, some blight resistance has
been bred into the hybrid for decades, Heisey said. Most commercial types now
have resistance, as do many back-yard varieties.
The great bank of heirloom seeds is ripe
for fresh creations and practical improvements, said Navazio of the Organic
Seed Alliance.
ÒWhen people say hybrids are better than
the OPs, well, duh! YouÕve been throwing all of your brainpower at developing
hybrids for more than 30 years. And the nonhybrids, the OPs, have sat and
languished with almost no one doing any good selection and genetic maintenance
on them. At that point, itÕs a self-fulfilling prophecy.Ó
His organizationÕs cause is not to
romanticize old seeds, he said. Instead, the Washington-state nonprofit hopes
to rebuild the regional farming culture that invented those cultivars. The
place for such a movement to start, Navazio argues, is the small farm. And the
people to do it are the farmers themselves.
As Siskiyou announces on the front page of
its website, ÒOur vision is to connect seed growers, gardeners and farmers in a
mutually beneficial relationship to support small-scale agriculture with
superior genetics selected for the Pacific Northwest.Ó
Put another way, Siskiyou isnÕt dealing in
nostalgia. What they pledge to sell is a better seed.
http://www.thespec.com/living/style/article/508244--the-cult-of-heirloomism
Source: New York Times News Service via SeedQuest.com
Return to Contents)
1.30 Genebanks could be
storing the wrong seeds
Scientists at the Netherlands' Center for
Genetic Resources led by Mark van de Wouw, have examined the extent of the
problem of non-authenticity of old cultivars in genebank collections. Large
lettuce collections from a Dutch genebank were sampled and DNA from seeds which
bear the same cultivar name were analyzed. The results of the DNA analysis
showed that many supposedly identical seeds did not match and levels of
authenticity were as low as 10%, especially in older cultivars.
Mark van de Wouw expressed his surprise
when he said "From my experiences with other genebanks I did suspect there
might be a problem with the authenticity of the seeds that was sent out to
users, but I did not realize the problem to be this large. Although current
procedures in the genebank avoid to a large extent that new mistakes are being
made, the level of mislabeling in the past has apparently been high. It is
obvious that systematized efforts need to be made to check the authenticity of
the heirloom cultivars in genebank collections."
The original news can be seen at https://www.crops.org/news-media/releases/2011/0308/460/
Source: Crop Biotech Update 11 March 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.31 'Tequila' plants as
biofuel crops
Agave is well-known for its role in the production
of alcoholic drink tequila, however, experts say that it is also a potential biofuel
crop, with better characteristics than other crops which are also used for
food and feed. According to several studies, agave plants can produce high
yields amidst extreme temperatures, droughts, and high levels of carbon
dioxide, with less irrigation.
Field trials of Mexican agave varieties
have started in Australia. According to one paper, two varieties (Agave
mapisaga and Agave salmiana) produce high yields under intensive management,
and far exceed corn, soybean, sorghum, and wheat yields.
"Mexico has 80 million hectares of
arid and semi-arid areas with no productive potential in which 5,600 million
tons of dry biomass could be obtained from agave," said Arturo Velez, head
of the Agave Project in Mexico. This would be enough to meet the United States'
transport fuel needs.
Read the papers from the Global Change
Biology issue on bioenergy at http://onlinelibrary.wiley.com/doi/10.1111/gcbb.2011.3.issue-1/issuetoc
Source: Crop Biotech Update 18 March 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.32 Scientists study
diversity between and within farmersÕ tomato varieites from Eritrea
Tomato (Solanum lycopersicum) is one of the
economically important crops in Eritrea. However, the average yield of tomato
in Eritrea is significantly smaller than the yield of tomato varieties from
Africa and Italy. Thus, Samuel Asgedom of the Hamelmalo Agricultural College in
Eritrea and colleagues analyzed the genetic diversity of 25 Eritrean tomato varieties
commonly grown by farmers and compared them with other African and Italian
varieties. Fifteen simple sequence repeat (SSR) molecular markers were used for
the genetic analysis.
The researchers observed a high degree of
diversity among the Eritrean varieties. Thirteen out of the 15 molecular
markers express different phenotypes. Two major types of varieties were
identified, and these are San-Marzano and Marglob. Eritrean varieties were also
found to have less uniform genotypes compared to the Italian and African
varieties. Based on a survey among the tomato farmers, some of them
intentionally mix seeds of different varieties to extend the harvesting period,
for yield stability, and stress tolerance.
Read the abstract of this study at http://www.academicjournals.org/AJB/PDF/pdf2011/21Mar/Asgedom%20et%20al.pdf
Source: Crop Biotech Update 25 March 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.33 Flood-tolerant rice
plants can also survive drought, say UC Riverside scientists
Riverside, California, USA
March 2, 2011
Rice, which is sensitive to drought due to
its high water requirement, is particularly vulnerable to how global climate
change is altering the frequency and magnitude of floods and droughts. If rice
plantsÕ combined tolerance to flooding and drought could be improved, however,
rice productivity could be protected and even substantially increased.
Now plant scientists at the University of
California, Riverside have made a discovery that can greatly benefit rice
growers and consumers everywhere. The researchers have demonstrated in the lab
and greenhouse that rice that is flood tolerant is also better able to recover
from a drought.
The images show rice plants treated with
drought, followed by recovery. Each image shows two kinds of rice plants. The
plants to the left of the red tape lack the Sub1A gene; the plants to the right
of the red tape have Sub1A. The image marked "Day 0" shows the plants
when the experiment began. The image marked "Day 8" shows the plants
on the eighth day of drought. The image marked "Recovery" shows that
only the plants with the Sub1A gene are recovering from drought stress after
the pot was regularly watered for 14 days after Day 8. Photo credit:
Bailey-Serres lab, UC Riverside.
ÒFlood tolerance does not reduce drought tolerance
in these rice plants, and appears to even benefit them when they encounter
drought,Ó said Julia Bailey-Serres, a professor of genetics in the Department
of Botany and Plant Sciences,
who led the research project.
Bailey-Serres and her team – Takeshi
Fukao, a senior researcher, and Elaine Yeung, an undergraduate student –
focused on Sub1A, a gene responsible for flood or ÒsubmergenceÓ tolerance in
rice and found only in some low-yielding rice varieties in India and Sri Lanka.
Sub1A works by making the plant dormant during submergence, allowing it to
conserve energy until the floodwaters recede. Rice with the Sub1A gene can survive
more than two weeks of complete submergence.
Plant breeders have already benefited
farmers worldwide – especially in South Asia – by having
transferred Sub1A into high-yielding rice varieties without compromising these
varietiesÕ desirable traits—such as high yield, good grain quality, and
pest and disease resistance.
Bailey-SerresÕs lab found that in addition
to providing robust submergence tolerance, Sub1A aids survival of drought. The
researchers report that at the molecular level Sub1A serves as a convergence
point between submergence and drought response pathways, allowing rice plants
to survive and re-grow after both extremes of precipitation.
Study results appear in the January issue
of The Plant Cell. The journal has the highest impact factor of primary
research journals in plant biology. The research paper also has been selected
as a recommended read in the Faculty of 1000.
Bailey-SerresÕs lab investigated the
drought tolerance of flood-tolerant rice plants because her research team
wanted to be sure that the flood tolerance trait, which the lab has studied for many years, did not reduce the ability of the plant to endure
some of the other common stresses – such as drought.
ÒWe found that Sub1A properly coordinates
physiological and molecular responses to cellular water deficit when this
deficit occurs independently, as in a time of drought, or following
Ôdesubmergence,Õ which takes place when flood waters recede,Ó Bailey-Serres
said.
She explained that after a flood, a period
follows when the leaves that have been submerged lose water and become
dehydrated. Moreover, because a period of dehydration is part of the natural
progression of a flood, Sub1A also happens to have benefits after desubmergence
and is therefore important for drought tolerance as well.
ÒOur finding suggests that the plant
recovers well from drought by growing new shoots,Ó Bailey-Serres said. ÒThis is
something that is also seen with flooding.Ó
Next, colleagues of Bailey-Serres at the
International Rice Research Institute in the Philippines will test the Sub1A
rice for drought tolerance in the field.
The research was supported by a grant from
the U.S. Department of Agriculture (USDA) Cooperative State Research,
Education, and Extension Service to Bailey-Serres, who is the lead recipient of the 2008 USDA National Research
Initiative Discovery Award. Fukao is
the first author of the research paper.
http://www.seedquest.com/news.php?type=news&id_article=15117&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.34 Improving rice yield in salty soils
Malaysia
March 3, 2011
Researchers have measured the genetic
diversity of saline tolerant rice from across India. This analysis is used to
predict which genotypes should be used to develop higher yields in difficult,
salt rich soil conditions, and the work is published in Pertanika Journal of Tropical
Agricultural Science (JTAS)
this month.
The presence of excess salt is one of the
most widespread soil toxicity problems in many rice growing areas. In
particular, it accounts for 8.5 million hectares of land in India and the yield
reduction is estimated at 30-50%.
The success of any breeding programme is
dependent on the available genetic divergence in the crop. Dr. A. Anandan and
colleagues measured genetic diversity in forty-four salt tolerant rice types
from different geographical regions. They analysed the genetic relationships
among extant genotypes in order to provide information about genetic diversity.
They divided the seeds into 12 clusters. The results suggest that geographical
distribution is not necessarily related to genetic divergence, with several
diverse regions appearing in the same clusters. They also found that genotypes
from the same geographic region appeared in different clusters, and may be due
to genetic heterogeneity – i.e. different genes producing identical
phenotypes.
They identify promising genotypes for
future use in breeding to develop saline tolerant genotypes and estimate the
relationship between measurable traits associated with yield under a saline
environment.
Facts about rice are available from the
International Rice Research Institute website: http://irri.org/about-rice/rice-facts
Pertanika Journal of Tropical
Agricultural Science
(JTAS) is published by Universiti Putra Malaysia in English and is open to
authors around the world regardless of nationality. It is currently published
twice a year in February and August. Other Pertanika series include Pertanika
Journal of Science & Technology (JST), and Pertanika Journal of Social
Sciences & Humanities (JSSH).
http://www.seedquest.com/news.php?type=news&id_article=15138&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.35 Molecular marker screening of tomato germplasm for
root-knot nematodes resistance
March 4, 2011
Tomato (Solanum lycopersicum L.), an
economically important vegetable, has been frequently savaged by root-knot
nematodes causing production losses in Ghana. The use of effective nematicides
have been banned due to their environmental and health risks. Previous studies
have shown that the gene Mi found in tomatoes confers genetic resistance to
root-knot nematodes. Thus, Y. Danso of Crops Research Institute (CSIR), Kumasi,
Ghana and other scientists, conducted molecular screening on some tomato
germplasm to detect markers of Mi.
Based on the results, the tomato cultivars
VFNT, FLA 505-BL 1172, 2641A, "Adwoa Deede" and Terminator FI showed
the marker for the homozygous resistant genotypes (Mi/Mi). The cultivars, Tima
and 2644A showed both markers, corresponding to heterozygous resistant
genotypes (Mi/mi). Twenty one (21) out of the 26 cultivars did not show any of
the markers probably because of non-specificity at the primer-binding sites.
Five (5) heterozygous individuals of the 6 resistant cultivars were found to be
following the Hardy-Weinberg equlibrium in population genetics.
Read the abstract of this study at http://www.academicjournals.org/AJB/abstracts/abs2011/28Feb/Danso%20et%20al.htm.
http://www.seedquest.com/news.php?type=news&id_article=15172&id_region=&id_category=&id_crop=
Source: Crop Biotech Update via
SeedQuest.com
(Return to Contents)
1.36 United Kingdom -
BASF launches new canopy assessment tool app for iPhone
United Kindgom
March 10, 2011
A new Canopy Assessment Tool App for iPhone
has just been launched by BASF in the UK for the 2011 season.
The CAT App for iPhone allows the user to
take a photo of their wheat crop at growth stage 30-31 and the green area index
(GAI) of that crop will be immediately reported on the iPhone in the field.
Accurately assessing a crop's GAI can be tricky, but its a critical indicator
for fertiliser and agrochemical application timings. From this GAI assessment,
with information on the variety grown and predicted yield, the CAT will provide
a tailored field report on lodging risk, a tailored PGR programme, and crop
nitrogen content (in kg/ha) measured for fertiliser calculations.
The BASF CAT is a revolutionary tool to
help farmers and advisors protect their yield by assessing crop lodging risk.
It is an easy to use practical aid, allowing appropriate PGR programmes to be
devised and calculating crop nitrogen requirements accurately. It helps to
justify inputs and is very much a part of an on-going ICM approach.
The CAT App for iPhone replicates the
on-line tool hosted at www.pgrplus.basf.com launched in 2010.
The BASF CAT App for iPhone can be
downloaded from iTunes.
The main benefits of the CAT App for iPhone
over the on-line tool are:
- The possibility to process photos immediately
in the field for an instant crop report.
- Ability to email crop photos and report at the
touch of a button
- A GPS mapping function which plots the
location of crop assessments on a google map, built into the Apps
- Save function - ability to store photos and
reports
- Possibility to process other photographs
either captured by the iPhone previously or sent via email & accessed
by the iPhone.
- Simple and fast interface.
http://www.seedquest.com/news.php?type=news&id_article=15324&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.37 Research finds path
to corn smut resistance
St. Louis, Missouri, USA
March 18, 2011
The National Corn Growers Association
funded research recently released by The Danforth Plant Science Center that may
lead to a variety of corn that is highly resistant to corn smut caused by the
fungus Ustilago maydis. With no genetic resistance to this fungal infection,
smut fungi are agents of disease responsible for significant crop losses
worldwide; this research gives a path to find a resistance to the infection.
The results of this research, which was
conducted by principal investigator Dr. Thomas Smith and research associate Dr.
Dilip Shah, are published in the Plant Biotechnology Journal.
Corn is the most economically important
crop in the United States, and American corn farmers planted nearly 90 million
acres, generating nearly $50 billion in 2010. In addition to food and feed, the
current emphasis on biofuels has elevated the importance of corn in U.S.
agriculture in recent years.
Corn smut is an airborne fungus found most
frequently on ears, tassels and nodes. Sweet corn is more susceptible to corn
smut than is seed corn, with annual losses often as high as 20 percent in the
United States, where corn smut is responsible for approximately $1 billion in
crop losses annually overall.
Prior to the Danforth Center discovery,
there were no corn varieties that were naturally immune to Ustilago maydis.
Several methods to control the disease have been recommended including, crop
rotation, sanitation, seed treatments, application of fungicides and
modification of fertility and biological controls. Drs. Smith and Shah explored
an alternative approach using a naturally found killer protein, KP4, made by a
virus that lives in one specific strain of corn smut.
Toxicity studies have shown that the KP4
proteins are safe for humans and animals to consume. Smith and Shah will
continue to explore KP4 and other antifungal proteins ability to control other
pathogenic fungi.
"Applying our control method could
significantly reduce annual losses caused by corn smut and other fungi,"
said Smith. ÒPlants often require a number of genes to only partially protect
the plant from a particular fungal infection, making it difficult to use
traditional breeding methods to develop resistant lines. Here we have shown
that a single gene that can lend extremely robust protection, giving us hope
that there are other similar and effective solutions to be found in
nature."
http://www.seedquest.com/news.php?type=news&id_article=15528&id_region=&id_category=&id_crop=
Source:
SeedQuest.com
(Return to Contents)
1.38 Nuevos resultados
genŽticos sobre la calidad del trigo
Investigadores de la Universidad PolitŽcnica de
Madrid identifican nuevos genes implicados en la calidad panadera del trigo
Madrid, Spain
March 21, 2011
Las prote’nas del gluten son las
principales responsables de la calidad del trigo panadero. Sin embargo, no son
las œnicas. Investigadores de la ETSI Agr—nomos de la Universidad PolitŽcnica
de Madrid, tras dos a–os de ensayos, han localizado regiones cromos—micas del
trigo fuertemente correlacionadas con par‡metros de calidad, cuyo estudio
servir‡ para identificar nuevos genes relacionados con ella.
El trigo panadero (Triticum aestivum ssp
vulgare L.) es, junto con la cebada, el cultivo nacional m‡s importante en
tŽrminos de producci—n y de superficie cultivada. Los productos derivados de
este cereal, tanto el pan como las galletas, boller’a y pasteler’a son
alimentos que forman parte fundamental de la dieta en todos los hogares.
Durante los œltimos a–os se ha producido una gran proliferaci—n de nuevos
productos de este gŽnero, fruto de los trabajos realizados sobre la calidad
harinera del trigo blando, indispensables para poder satisfacer tanto las
exigencias de la industria como las preferencias de los consumidores.
La genŽtica de la calidad del trigo es
objeto de estudio desde hace muchos a–os de numerosos grupos de investigaci—n
nacionales e internacionales, entre los que se encuentra el Grupo de
Investigaci—n de Mejora GenŽtica de Plantas de la UPM, experto y referencia
nacional en este tema.
En el caso del trigo panadero, aunque las
prote’nas del gluten son los principales determinantes de la calidad, existen
evidencias que apuntan a que debe haber otros componentes de la harina
implicados, aœn por caracterizar, cuyo conocimiento ser’a de gran utilidad en
los programas de mejora.
Con el objetivo de profundizar en este
aspecto, los investigadores de la UPM generaron una colecci—n de l’neas
recombinantes de trigo derivadas del cruzamiento entre dos variedades
comerciales (ÒMariusÓ y ÒCajemeÓ) con distinta calidad. Se llevaron a cabo
ensayos de campo durante dos a–os, y se aplicaron las tŽcnicas est‡ndar en la
industria panadera para la evaluaci—n de las propiedades funcionales de la
harina, como son el an‡lisis del mix—grafo, el alve—grafo o el test del volumen
de sedimentaci—n. La realizaci—n de un mapa genŽtico con 300 marcadores de ADN
de tipo SSR (microsatŽlite) permiti— localizar en los cromosomas 2A, 7A y 5B
nuevos QTLs (quantitative trait loci), regiones cromos—micas que est‡n
fuertemente correlacionadas con los par‡metros de calidad estimados. Estos
cromosomas, que actualmente est‡n siendo estudiados en profundidad con un mayor
nœmero de marcadores, constituyen el punto de partida fundamental para la
identificaci—n de nuevos genes.
Los resultados del estudio forman parte de
una tesis doctoral y han sido publicados recientemente en Journal of Cereal
Science, revista cient’fica especializada(1).
(1)Kerfal, S; Giraldo, P; Rodriguez-Quijano,
M; Vazquez, JF; Adams, K; Lukow, OM; Roder, MS; Somers, DJ; Carrillo, JM;
Mapping quantitative trait loci (QTLs) associated with dough quality in a soft
x hard bread wheat progeny. JOURNAL OF CEREAL SCIENCE 52 (1): 46-52 JUL 2010.
http://www.seedquest.com/news.php?type=news&id_article=15605&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.39 Key plant traits
yield more sugar for biofuels
Research by UC Riverside's Charles Wyman could lead
to less expensive production of biofuels
Riverside, California, USA
March 28, 2011
New clues about plant structure are helping
researchers from the Department of EnergyÕs BioEnergy Science Center narrow down a large collection of poplar tree
candidates and identify winners for future use in biofuel production.
Led by Charles Wyman of the Bourns College of EngineeringÕs Center for
Environmental Research and Technology
at the University of California, Riverside, a research team from Oak Ridge
National Laboratory, the National Renewable Energy Laboratory and UCR
determined that the amount and composition of lignin in the plantÕs cell wall
interact in an unanticipated way to influence release of sugar from the plant.
The research was published as ÒLignin content in natural Populus variants affects
sugar release,Ó in the Proceedings
of the National Academy of Sciences.
Lignin serves as a major roadblock for
biofuel production because it forms strong bonds with sugars and interferes
with access to these carbohydrates, making it difficult to extract the plantÕs
sugars contained in cellulose and hemicellulose for conversion to
transportation fuels.
ÒThe real driver for bioenergy is how to
get sugar as cheaply as possible from these recalcitrant materials,Ó Wyman
said. ÒWeÕre looking for clues as to which traits in these poplar materials
will lead to better sugar release.Ó
Using a high-throughput screening method,
the BESC researchers rapidly analyzed an unprecedented number of poplar core
samples in their search to understand the chemical factors that drive sugar
yields.
The analysis revealed a correlation between
one plant trait, the S/G ratio, and increased sugar yields. The ratio refers to
the two main building blocks of lignin – syringyl and guaiacyl subunits.
"The conventional wisdom is that high
lignin contents are bad for sugar release," said lead author Michael
Studer. "We unexpectedly found that this statement is only valid for low
S/G ratios, while at high S/G ratios lignin does not negatively influence
yields. However, replacement of carbohydrates with lignin reduces the maximum
possible sugar release."
"Another interesting result was that
the samples with the highest sugar release belonged to the group with average
S/G ratios and lignin contents. This finding points to a need for deeper
understanding of cell wall structure before plants can be rationally engineered
for efficient biofuels production,Ó Studer said.
The teamÕs study also pinpointed certain
poplar samples that produced unusually high sugar yields with no pretreatment.
Biofuel production typically requires various pretreatments, such as applying
high temperature and pressure to the biomass. Reducing pretreatment would
represent a substantial decrease in the price of liquid transportation fuels
produced from lignocellulosic feedstocks like poplar.
ÒIt's very enticing that several of the samples
released more sugar than typical with no pretreatment,Ó Wyman said.
Poplar trees, botanically known as Populus,
represent the leading woody crop candidate for the production of biomass
feedstocks for the creation of biofuels in the U.S. Naturally occurring
selections of poplar trees contained wide variations in all observed traits,
says Gerald Tuskan, an ORNL plant biologist and one of the co-leads of the
study.
ÒWe can mine this natural variability and
find extreme poplar phenotypes that have value in increasing sugar yield,Ó
Tuskan said. ÒMoreover, these native individuals are adapted to local
environments.Ó
From this work, superior poplar cultivars
may soon be available for commercial testing and propagation, yielding plant
materials that will contribute to reducing the nationÕs dependence on fossil
fuel based transportation fuels.
The team, supported by BESC at ORNL,
included co-lead Mark Davis and Robert Sykes from the National Renewable Energy
Laboratory, Jaclyn DeMartini from UCR, and Brian Davison and Martin Keller from
ORNL.
BESC is one of three DOE Bioenergy Research
Centers established by the DOE's Office of Science in 2007. The centers support
multidisciplinary, multi-institutional research teams pursuing the fundamental
scientific breakthroughs needed to make production of cellulosic biofuels, or
biofuels from nonfood plant fiber, cost-effective on a national scale. The
three centers are coordinated at ORNL, Lawrence Berkeley National Laboratory
and the University of Wisconsin-Madison in partnership with Michigan State
University.
The Bourns College of Engineering's Center
for Environmental Research and Technology (CE-CERT) at UCR is a model for
partnerships between industry, government and academia. It is a recognized
leader in research and education in the areas of atmospheric processes,
emissions and fuels, sustainable energy and transportation systems.
ORNL is managed by UT-Battelle for the
Department of Energy's Office of Science
http://www.seedquest.com/news.php?type=news&id_article=15731&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
1.40 Promising results
for breeding drought-resistant cowpea
Cowpea or black-eyed pea has been a source
of protein for humans and livestock. The plant can be easily cultured because
it is a nitrogen fixer, hence it doesn't need much fertilizer and is resistant
to many diseases. Its crude protein which can be up to 30 percent in improved
varieties make it an important substitute for animal meat protein during times
of high food price and economic crisis.
With problems on climate change and
agriculture planting patterns, cowpea can be bred to be resistant to drought
and high temperatures. Researchers at Texas AgriLife Research are breeding
cowpea with these traits in mind and already found one major gene for drought
tolerance. Other traits which they hope to improve using germplasm from
different sources include short duration and pest resistance.
For details of this news, see http://agrilife.org/today/2011/01/31/promising-results-for-breeding-drought-resistant-cowpea/
Source: Crop Biotech Update 4 February 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.41 Two genes better
than one for important plant pest
Bacterial pathogen Pseudomonas syringae,
the causal organism affecting a number of important economic crops such as
rice, corn, soybeans, tomatoes, cucumbers, many legumes, and most recently the
chestnut trees in the UK, was found to have two genes that code for the 'pili'
- the needle-like structure that penetrate and inject a range of
disease-causing proteins into plant cells. This finding by researchers from the
Imperial College of London led by Jšrg Schumacher, senior author of the study
and published in Nature Communications is believed to be a unique evolutionary
development for the bacteria's infection mechanism.
With this information, researchers will
look deeper into the molecular mechanisms on crop pest/host interaction in the
hope that a more targeted and sophisticated method of control can be developed
in its range of hosts.
For more details, see the original article
at http://www.bbsrc.ac.uk/news/food-security/2011/110201-pr-two-genes-better-than-one.aspx
Source: Crop Biotech Update 4 February 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.42 Evaluation of the
brown planthopper resistance genes in hybrid rice
The brown planthopper (BPH) is one of the
most devastating insect pests of rice in Asia. BPH is a sap-feeding insect that
causes "hopper-burn" and could also be a vector for rice grassy stunt
virus and ragged stunt virus. Use of pesticides to combat this pest is costly
and could also cause the decrease in the population of other beneficial insects
in the field. Rice variety Shanyou 63, which was widely cultivated in China,
has decreased in production due to its susceptibility to pests such as BPH. To
increase BPH resistance in rice hybrids like Shangyou 63, Jie Hu of Huazhong
Agricultural University, China, and colleagues, used marker-assisted
selection introgression of BPH resistance genes (Bph14 and Bph15).
Results of the study showed that improved
hybrids introgressed with only one gene have enhanced resistance to BPH than
the conventional varieties, but those introgressed with both genes have higher
resistance. The researchers also found out that both genes are partial dominant
genes meaning, no trait is fully dominant over another, thus, the genes could
be used to breed BPH-resistant hybrids. Results of the field trials showed that
the improved hybrids produce more yield.
For more details about this study, visit http://www.springerlink.com/content/d73422711562367n/
Source: Crop Biotech Update 18 February
2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.43 Global wheat rust
project gets US$40 M support
The United Kingdom's Department of
International Development (DFID) and the Bill & Melinda Gates Foundation
will award a US$40 million grant to the Durable Rust Resistance in Wheat (DRRW)
project at Cornell University. The grant will support efforts to identify new
stem rust resistant genes in wheat, improve surveillance, and multiply and
distribute rust-resistant wheat seed to farmers.
"We cannot overstate the importance of
this announcement on the part of two of the most important funders of solutions
for addressing the causes of poverty, hunger and disease in the developing
world," said Ronnie Coffman, Cornell professor of plant breeding and
genetics and director of the DRRW. "Against the backdrop of rising food
prices, and wheat in particular, researchers worldwide will be able to play an
increasingly vital role in protecting wheat fields from dangerous new forms of
stem rust, particularly in countries whose people can ill afford the economic
i! mpact of damage to this vital crop."
Partners in the project include national
research centers in Kenya and Ethiopia, and scientists at the International
Maize and Wheat Improvement Center (CIMMYT), and the International Center for
Agricultural Research in the Dry Areas (ICARDA).
For more information on DRRW, go to http://www.globalrust.org
Source: Crop Biotech Update 04 March 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics,
Cornell University
Mes25@cornell.edu
(Return to Contents)
1.44 Release of insect
resistant maize hybrids:
The Insect Resistant Maize for Africa
(IRMA) project recorded a tremendous success in 2010 with the release of six
maize varieties. The released varieties are hybrids that have post- harvest and
stem borer resistance, which means they are
not susceptible to damage by pests such as
the maize weevil and the larger grain borer (LGB). Under the IRMA project,
CIMMYT, working alongside the Kenya Agricultural Research Institute (KARI),
submitted 12 maize hybrids to the Kenya National Performance Trials (NPT) for
testing during 2008-2010.
Source: CIMMYT Informa 11 February 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics, Cornell
University
Mes25@cornell.edu
(Return to Contents)
1.45 Cient’ficos
espa–oles logran plantas resistentes a diferentes virus inhibiendo un œnico gen
Madrid, Spain
March 8, 2011
Un grupo de investigadores del Centro de
Edafolog’a y Biolog’a Aplicada del Segura (CEBAS-CSIC), ha desarrollado un
mŽtodo para generar variedades de cucurbit‡ceas (familia del mel—n, pepino,
sand’a o calabazas) resistentes a varias enfermedades virales. Esto se ha
conseguido silenciando un gen de la planta que codifica una prote’na utilizada
por el virus en su beneficio para multiplicarse en las cŽlulas vegetales.
Segœn recoge la Agencia SINC, la peculiaridad de este mŽtodo es que se obtiene
una planta mejorada genŽticamente sin introducir ningœn elemento ajeno a la
propia especie. El gen silenciado es utilizado en la replicaci—n de varios
tipos de virus, por lo que se obtienen plantas resistentes a varias
enfermedades virales, sin necesidad de tratamientos adicionales.
Los investigadores han comenzado sus
estudios con el mel—n ya que es la especialidad del equipo. De las nueve
enfermedades causadas por virus que se han ensayado en plantas de mel—n
transgŽnico, en cuatro de ellas las plantas no enfermaban.
Este estudio es de gran interŽs ya que las
enfermedades v’ricas que afectan a las cucurbit‡ceas causan grandes pŽrdidas
econ—micas cada a–o. Adem‡s, Espa–a es un gran exportador del mel—n, entre un 5
y un 10% anual de la producci—n espa–ola.
http://www.seedquest.com/news.php?type=news&id_article=15253&id_region=&id_category=&id_crop=
Source: Seed!Quest.com
(Return to Contents)
1.46 DNA
Markers for Marker-Assisted Breeding
March 2011
by Asgar Shir
Modern plant
breeding relies heavily on the application of molecular (DNA) markers in
selecting superior lines or individuals. Different types of molecular markers
are used in the laboratories around the world. IÕm often questioned which
marker is the best for marker-assisted selection and my answer is that a good
genetic marker should have all or most of the following criteria:
- Polymorphic: the essence of the selection is the variability.
- Multiallelic: several alleles at a same locus.
- Codominant: a heterozygous marker shows the
characteristics of the two alleles possible in a diploid species.
- None epistatic: no
dominance over another marker (no inter-locus interactions).
- Automation: the process
can be easily automated to increase the throughput.
- Throughput: can multiplex a large number of markers
together and run simultaneously.
- Reproducible:
Consistent across laboratories.
- Low cost: very important
factor in agriculture where thousands of samples are tested.
The table below
compares the most common markers in plant and animal breeding.
|
|
RFLPs |
RAPDs |
AFLPs |
SSRs |
SNPs |
|
DNA quality |
high |
high |
moderate |
moderate |
high |
|
PCR based |
no |
yes |
Yes |
yes |
yes |
|
Polymorphism |
moderate |
high |
High |
high |
high |
|
Codominant |
yes |
no |
No |
yes |
yes |
|
Ease to use |
not easy |
easy |
med. easy |
easy |
easy |
|
Automation |
low |
moderate |
moderate |
high |
very high |
|
Reproducibility |
high |
med |
High |
high |
high |
|
Development cost |
low |
low |
moderate |
high |
high |
|
Cost per analysis |
high |
low |
moderate |
low |
low |
According to the
criteria above there are 2 PCR-based markers that stand out: SSR (Simple
Sequence Repeats) and SNP (Single Nucleotide Polymorphism). In the following
section, I will briefly explain each of these markers and highlight the most
important characteristics of each one.
SSR markers
Simple Sequence
Repeat (SSR) or also known as microsatellite or Short Tandem Repeat (STR) is a
short repeat of nucleotide sequences that can be mono, di, tri or tetra and up
to 7 nucleotides.
Examples of such repeats
are: (A)n, (TC)n, (TAT)n, (GATA)nÉ, where n indicates the number of repetitions
of microsatellite. Following is an example of a dinucleotide motif (CT)
that repeats 7 times.
5Õ flanking
region
Microsatellite
locus
3Õ flanking
region
ÉCGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGGÉ
Microsatellites
are PCR-based markers that are co-dominant, reproducible and multi-allelic and
can be automated to increase throughput. Among all the characteristics of
microsatellites perhaps the most important ones are related to breeding
application and the fact that they are well dispersed throughout the genome.
SSRÕs can also detect multiple alleles for a given locus. The
multi-allelic character of SSR markers makes them a very attractive DNA marker
for plant breeding. They can easily detect 10-20 alleles for a given locus in a
population.
SNP markers
Single Nucleotide
Polymorphisms (SNP) is a single base change in a genomic DNA sequence.
1...GATATTCGTACGGATGT-TCCA...
2...GATGTTCGTACTGATGTATCCA...
3...GATATTCGTACGGATGT-TCCA...
4...GATATTCGTACGGATGTATCCA...
5...GATGTTCGTACTGATGTATCCA...
6...GATGTTCGTACTGATGTATCCA...
6 Individuals are
classified to 3 distinct Haplotypes: AG– (1 & 3), AGA (4), GTA (2, 5 &
6)
SNPs are generally
bi-allelic markers meaning there are two alleles that an individual may have
for any particular marker. This means that the information content per SNP
marker is relatively low when compared to microsatellite markers. It is estimated
that it will take approximately 5 SNP markers to equal the information of one
microsatellite marker, meaning that ~2,000 SNPs will be required to equal a 10
cM microsatellite map. However, SNPs are abundant in all genomes and can be
found approximately every kilobase (1,000 base pairs). They are also spread
evenly throughout the genome. This offers the potential for generating very
high density genetic maps, which will be extremely useful for developing
haplotyping systems for genes or regions of interest. They may be the
polymorphisms associated with the gene of interest under study and therefore
direct selection of the gene is possible.
The types of
markers are many and if more information is needed please contact us directly
at ESTA and we will be more than happy to answer your questions.
http://www.eurofinsus.com/ESTA_enews/Mar2011DNAMarkersAsgar.html
Source:
SeedQuest.com
(Return to Contents)
1.47 Cloned seeds show
promise for crop breeding
Hyderabad, India
March 4, 2011
Seeds have been cloned for the first time,
a move which could speed up crop breeding and one day allow farmers to produce
their own high-yielding seed.
Most crop varieties are hybrids with a
mixture of characteristics from genetically distinct parents. But their useful
traits are not passed on to their seeds because sexual reproduction, which
involves two parents, shuffles genes.
Now an international team of scientists has
forced plants to produce seeds that are identical to themselves genetically
(i.e. cloned), rather than containing a mix of genes from themselves and
another parent.
The seeds have thus retained all the useful
traits of their parent.
Imran Siddiqi, researcher at the Centre for
Cellular and Molecular Biology, India, and one of the authors of the paper,
published in Science last month(18 February), called this a "proof of
principle" of what has long been only a theory.
The key to what they have done lies in the
fact that some plants naturally reproduce asexually, by 'apomixis', where the
offspring are identical to the parent. They have managed to make a plant that
usually makes seeds sexually do so by this method instead.
Siddiqi said the process involved
manipulating 2–4 genes that retain parental genetic material in a seed.
He told SciDev.Net that the process would
make it possible to 'fix' desirable traits in crops without going through the
several generations of cross breeding that are normally required.
"This is a real boost to the field of
plant genomics as a whole," said Siddiqi. "But application is still a
long way off."
The method creates clones in around a third
of offspring in the model plant species Arabidopsis.
Commercial use would require at least
85–90 per cent of seeds to be successfully cloned, he said.
The publication has generated interest
among plant scientists in India but they recognise that this is the first step
on a long road.
P. B. Kirti, professor of plant sciences at
the University of Hyderabad, told SciDev.Net that demonstrating that the method
works for important crops would be a "huge challenge" and reaching
field trials would take years of work and considerable financing.
"Getting good genetic material to work
on and take this proof of concept further also poses its own challenges,
particularly to scientists in developing countries," he added.
Siddiqi agreed: "To take this forward
would certainly require a more concerted effort — a greater level of
funding, a policy-level commitment and wider collaboration."
He said provisional patents have been filed
for the process. "If and when application becomes a reality, the
technology should remain accessible to public institutions."
Link to full paper in Science
http://www.seedquest.com/news.php?type=news&id_article=15186&id_region=&id_category=&id_crop=
Source:
SeedQuest.com
(Return to Contents)
1.48 Arabidopsis
anticipates mildew attack in the morning
Wei Wang of Duke University and colleagues
discovered that Arabidopsis cranks up its immune system in the morning in
preparation for the greatest infestation of spores from Hyaloperonospora, a
downy mildew. This is the first finding about the plant's defense system
cycling on a daily basis even in the absence of pathogens. Since it is
expensive to produce chemical compounds that protects Arabidopsis from downy
mildew, thus a circadian cycle of production is safer and more efficient.
Wang discovered this connection between the
circadian clock and plant immunity during their general search for genes linked
to the immune system of Arabidopsis. They found 22 genes related to immune
response to downy mildew and a number of those genes exhibited rhythmic
expression patterns. The expression patterns were monitored and they observed
that the defense genes are expressed by schedule even in the absence of
pathogens. To test this hypothesis, they exposed th! e plants to mildew spores
at dawn and at dusk and infection rates were found to be higher during dusk.
They used "clock mutants" that
lack the circadian clock regulator (CCA1) and results show that these mutants
had higher infection rates than normal plants.
Read more details at http://www.nature.com/nature/journal/v470/n7332/full/nature09766.html
Source: Crop Biotech Update 4 February 2011
Contributed by Margaret Smith
Dept of Plant Breeding and Genetics, Cornell
University
Mes25@cornell.edu
(Return to Contents)
1.49 Phytochemicals of Brassicaceae in plant protection
and human health – Influences of climate, environment and agronomic
practice
Maria Bjorkman a,1, Ingeborg Klingen a,⇑,1,
Andrew N.E. Birch b, Atle M. Bones c, Toby J.A. Bruce d, Tor J. Johansen e,
Richard Meadow a, Jorgen Molmann e, Randi Seljasen f, Lesley E. Smart d, Derek
Stewart b
a Norwegian Institute for Agricultural and
Environmental Research (Bioforsk), Plant Health and Plant Protection Division,
H¿gskoleveien 7, N-1432 s, Norway
b Scottish Crop Research Institute (SCRI),
Invergowrie, Dundee, DD2 5DA Scotland, UK
c Norwegian University of Science and
Technology (NTNU), Department of Biology, NO-7491 Trondheim, Norway
d Rothamsted Research, Harpenden,
Hertfordshire AL5 2JQ, UK
e Norwegian Institute for Agricultural and
Environmental Research (Bioforsk), Arctic Agriculture and Land Use Division,
P.O. Box 2284, 9269 Troms¿, Norway
f Norwegian Institute for Agricultural and
Environmental Research (Bioforsk), Arable Crop Division, 4886 Grimstad, Norway
Received 25 June 2010
Received in revised form 13 December 2010
Keywords:
Carotenoids, Environmental factors,
Epicuticular waxes, Glucosinolates, Human health, Integrated pest management,
Polyphenolics, Secondary metabolites,Tocopherols
A b s t r a c t
In this review, we provide an overview of
the role of glucosinolates and other phytochemical compounds present in the
Brassicaceae in relation to plant protection and human health. Current
knowledge of the factors that influence phytochemical content and profile in
the Brassicaceae is also summarized and multi-factorial approaches are briefly
discussed. Variation in agronomic conditions (plant species, cultivar,
developmental stage, plant organ, plant competition, fertilization, pH),
season, climatic factors, water availability, light (intensity, quality,
duration) and CO2 are known to significantly affect content and profile of
phytochemicals. Phytochemicals such as the glucosinolates and leaf surface
waxes play an important role in interactions with pests and pathogens. Factors
that affect production of phytochemicals are important when designing plant
protection strategies that exploit these compounds to minimize crop damage
caused by plant pests and pathogens. Brassicaceous plants are consumed
increasingly for possible health benefits, for example, glucosinolate-derived
effects on degenerative diseases such as cancer, cardiovascular and
neurodegenerative diseases. Thus, factors influencing phytochemical content and
profile in the production of brassicaceous plants are worth considering both
for plant and human health. Even though it is known that factors that influence
phytochemical content and profile may interact, studies of plant compounds
were, until recently, restricted by methods allowing only a reductionistic
approach. It is now possible to design multi-factorial experiments that
simulate their combined effects. This will provide important information to
ecologists, plant breeders and agronomists.
2011 Elsevier Ltd. All rights reserved
Contributed by Nick Birch
Scottish Crop Research Institute (SCRI)
(Return to Contents)
1.50 How do plants fight
disease?
Breakthrough research by UC Riverside plant
pathologist offers a clue
Riverside, California, USA
March 28, 2011
How exactly bacterial pathogens cause
diseases in plants remains a mystery and continues to frustrate scientists
working to solve this problem. Now Wenbo Ma,
a young plant pathologist at the University of California, Riverside, has
performed research on the soybean plant in the lab that makes major inroads
into our understanding of plant-pathogen interactions, a rapidly developing
area among the plant sciences.
Her breakthrough research can help
scientists come up with effective strategies to treat crops that have succumbed
to disease or, when used as a preventative measure, to greatly reduce their
susceptibility to disease.
In a paper
published in the March issue of the journal Cell Host & Microbe, Ma,
an assistant professor of plant
pathology and microbiology, and her
colleagues show that the bacterial pathogens target isoflavones, a group of
compounds in plant cells that defend the plant from bacterial infection,
resulting in a reduction in isoflavone production.
An arms race
First, the pathogens inject virulence
bacterial proteins, called HopZ1, through needle-like conduits into the plant
cells. These proteins then largely reduce the production of the isoflavones and
promote disease development. However, by sensing the presence of HopZ1, the
plants mount a robust resistance against the pathogen, including the production
of a very high amount of isoflavones. At this point, the pathogen must come up
with new strategies by either changing the kind of proteins it injects into the
plant, not injecting any proteins at all, or injecting virulence proteins in a
way that helps them escape detection by the plant. In this way, the virulence
bacterial proteins and the plant host engage in an endless Òarms race.Ó
ÒOne question we are still trying to answer
is how at the molecular level the bacterial virulence proteins promote
disease,Ó Ma said. ÒSome scientists have shown that these proteins block
signaling transduction pathways in the plant, which eventually weakens plant
immunity. We are introducing a fresh perspective on this topic, namely, that
the pathogens evolved strategies to directly attack the production of plant
antimicrobial compounds, such as isoflavones, thus compromising the plantÕs
defense mechanism.Ó
Closing the circle
According to Ma, her results can be
extrapolated to understand how plants defend themselves when attacked by
pathogens. She is pleased to be resuming research first studied by UC
RiversideÕs Noel Keen,
the late plant scientist and a pioneer in molecular plant pathology, who did
fundamental groundbreaking work on understanding how isoflavones and
isoflavone-derived compounds play a role in defending plants against microbial
infection.
ÒThis was an important topic of study about
30 years ago, but then the topic was dropped by researchers and it lost
momentum,Ó Ma said. ÒMy lab is now revisiting the problem. Of course, we still
have many questions to answer. We need to fully understand how isoflavones
function to protect plants so that we can design specific strategies aimed at
better protecting the plant.Ó
Looking forward
MaÕs lab is also interested in
understanding what makes pathogens what they are. Why is it that among
ecologically similar bacteria, some cause disease while others do not? Her lab
is also studying how plants evolve mechanisms to protect themselves from
infection, how pathogens subvert this defense and become virulent again.
ÒPathogens get wise to the disease-fighting
strategies we use in agriculture,Ó Ma said. ÒThis is evolution at work. But
with fundamental knowledge on how pathogens cause disease we can develop
sustainable and applicable strategies to combat disease.Ó
About Wenbo Ma
Ma received her doctoral degree in biology
in 2003 at the University of Waterloo, Canada. Thereafter, she did postdoctoral
research for three years at the University of Toronto, Canada. She joined UCR
in 2006. Her awards and honors include a RegentsÕ Faculty Fellowship at UCR, a
postdoctoral fellowship from the Natural Sciences and Engineering Research
Council of Canada, and the W.B. Pearson Medal from the University of Waterloo.
She chose the soybean plant to study
because the pathogen she was interested in, Pseudomonas syringae,
attacks the soybean plant. Soybean is the second largest crop and the largest
agricultural export in the United States. In addition to being an important
human and animal food crop, it is also a major feedstock for biodiesel.
Ma was joined in the research by UCRÕs
Huanbin Zhou (first author of the research paper and a postdoctoral researcher
in the Ma group), Jian Lin, Aimee Johnson, Robyn Morgan and Wenwan Zhong.
Zhong is an assistant professor in the Department of Chemistry.
The research study was supported by grants
from the National Science Foundation, UCR-Los Alamos National Laboratory
collaborative program for plant diseases and the U.S. Department of Agriculture
Experimental Station Research Support Allocation Process.
http://www.seedquest.com/news.php?type=news&id_article=15751&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
=========================
2.01 New book: ÔBreeding crops with resistance to
diseases and pestsÕ
Wageningen, The Netherlands
March 2, 2011
The book ÔBreeding crops with resistance to
diseases and pestsÕ was published on 1 March. The book provides important
up-to-date information about plant-pathogen principles for plant breeders who
wish to introduce resistance to diseases and pests into their crops.
A large part of the book deals with the
many options that are open to breeders: testing seedlings or mature plants for
resistance? In the greenhouse or in the field? With a mixture of pathogen
strains or with a pure strain? Each of those choices has its advantages and
disadvantages and these are discussed in clear terms.
The book contains numerous examples,
further details and interesting exceptions, and these are typographically
easily distinguishable from the main text; this makes it easy for students to
separate main issues and side issues. The book also contains many self-test
exercises with the answers and further information in the back of the book. The
book also contains a terminology list with definitions.
ÔBreeding crops with resistance to diseases
and pestsÕ is not only of interest to students but also to practical plant
breeders working in companies and institutions who are planning to set up a
breeding programme for resistance.
This book fills a gap because an academic
textbook on this subject had not been published until now. From now on it will
be used in the lectures given by the Plant Breeding Chair Group.
ÔBreeding crops with resistance to diseases
and pestsÕ has been written by four authors with a lot of experience and
expertise in resistance research of the Plant Breeding Chair Group of
Wageningen University: Rients Niks (photo), Jan Parlevliet, Pim Lindhout and
Yuling Bai. The book can be ordered from Wageningen Academic Publishers.
http://www.seedquest.com/news.php?type=news&id_article=15145&id_region=&id_category=&id_crop=
Source: SeedQuest.com
(Return to Contents)
2.02 FAO policy guide: Promoting the Growth and
Development of Smallholder Seed Entrprises for Food Security Crops
1 March 2011, Rome – Small seed enterprises are the best way of
ensuring the availability and quality of non-hybrid seeds for food and feed
crops in developing countries, said FAO in a policy guide published today.
According to the World Bank, up to 50
percent of crop yield increases have come from improved seeds, while farmers'
access to quality seeds is a key factor for better food and nutrition in poor
countries.
In recent years, however, a large number
governments in the developing world reduced public investment in the seed
sector, the expectation being that the private sector would fill the gap.
In many places, especially Africa, this has
not happened as medium and large seed companies tend to concentrate on
producing hybrid seed for high value crops grown by larger farmers and market
them in more fertile, wealthier areas.
Sharing not enough
As a result, only about 30 percent of
smallholder farmers in developing countries use seed of improved varieties of
variable quality — in Africa the percentage is smaller still.
Hybrid seeds provide better yields
and disease resistance but cannot be saved by farmers for the next
planting, as the hybrid plant seeds do not reliably produce true copies.
The majority of poor smallholder
farmers growing food security crops such as sorghum, millet and cassava rely on
self or open-pollinated seeds or crops that are propagated through dividing
bulbs, or taking cuttings stored from previous harvests and grafting them.
However, they do not always have access to
new varieties that can help them increase production using the same amount of
inputs.
"It doesnÕt cost a lot comparatively
to set up a seed enterprise, especially when it involves local farmers' organizations,
but as case studies in the policy guide from three continents have shown, such
enterprises can be highly effective in improving food output," said
Shivaji Pandey, Director of FAOÕs Plant Production and Protection Division.
Brazil, India, Cote DÕIvoire
The policy guide, entitled ÒPromoting the
Growth and Development of Smallholder Seed Enterprises for Food Security CropsÓ, is based on case studies from Brazil, India and
C™te d'Ivoire, the results of which have been published separately by FAO.
In all three cases, a favorable policy
environment was found to be a key requirement to the successful development of
smallholder seed enterprises.
Examples include an efficient quality
control and certification system, private sector support, flexible legislation
and the legal recognition of the rights of farmers to save, exchange and sell
seeds of commercial varieties.
Private sector support
Support for privatization and
commercialization of agricultural services and the support of plant breeder
rights are also imperative. Other factors that can help farmers set up
small-scale seed enterprises include reduced tariffs for the import of
seed-cleaning and other equipment, key to establishing a seed industry, as
adopted by the government of C™te d'Ivoire.
Credit must also be available to seed
producers; lack of credit was seen as a major hindrance to seed enterprise
development and seed producers should be given assistance to run marketing and
communications campaigns including the use of rural radio networks to advertise
improved varieties to farmers.
Marketing help
"Sometimes the seed is there but
farmersÕ organizations need assistance and guidance in marketing it to other
farmers," said Pandey. Many small-scale seed enterprises have been
developed with the support of donors or NGOs but this can lead to aid
dependency if both technical and entrepreneurial capacities are not developed
for self-reliance, the FAO document warns.
It is hoped that legislation governing
seeds for the whole of Africa will eventually be harmonized to make it easier
for new varieties to cross borders. This is of particular importance because of
climate change which is increasing the need for more resilient varieties.
Therefore, new hybrid seed must be
purchased for each planting. The seed of self-pollinated crops (wheat and
beans, for example) can be saved by farmers for next planting.
Generally speaking, seed purchased from
qualified and reliable seed producers is better in purity, germination and
overall quality regardless of whether is hybrid or non-hybrid seed.
http://www.fao.org/agriculture/crops/core-themes/theme/seeds-pgr/en/
Contributed by Kakoli Ghosh
Programme Entity
Leader
AGP - Seeds and Plant Genetic
Resources
Kakoli.ghosh@fao.org
(Return to Contents)
2.03 New publication on the origin of and centers of
diversity of maize in Mexico
Elementos para la determinaci—n de centros
de origen y centros de diversidad genŽtica para el caso de los ma’ces de MŽxico
a partir de los resultados del proyecto ÒRecopilaci—n, generaci—n,
actualizaci—n y an‡lisis de informaci—n acerca de la diversidad genŽtica de
ma’ces nativos y sus parientes silvestres en MŽxicoÓ (2006-2011).
http://www.biodiversidad.gob.mx/genes/pdf/proyecto/Elementos_recursosGeneticos_maices.pdf
Coordinaci—n de An‡lisis de Riesgo y
Bioseguridad
CONABIO
Parques del Pedregal
Tlalpan 14010, MŽxico D.F.
(Return to Contents)
3. WEB AND
NETWORKING RESOURCES
3.01 Information on
seeds from FAO
On the Seed-PGRFA website of FAO you can
now find information on a new handbook on Seeds in Emergencies as well
as an article from FAO media center regarding a recent publication on Small
Seed Enterprises.
Please visit http://www.fao.org/agriculture/crops/core-themes/theme/seeds-pgr/en/
(Return to Contents)
4.01 Wanted: global rice
science scholars
The Philippines
March, 2011
If you are about to enroll or conduct your
Ph.D. research, you could be one of a new generation of rice scientists with a Global Rice
Science Scholarship (GRiSS).
The 2011 GRiSS offers young agricultural
scientists the chance to be experts in a scientific discipline and to have a
broader understanding of global issues that affect rice science for
development.
This is a great opportunity for scientists
early in their career who are working in a national agricultural research and
extension system in developing countries.
Research areas covered by the scholarship
include rice science and related systems research, particularly on agronomy,
crop physiology, entomology, plant pathology, soil and water science,plant
breeding, and the social sciences.
GRiSS falls under the framework of the Global Rice Science Partnership (GRiSP), a single strategic goal and work plan for
global rice research. GRiSP is led by IRRI and involves other centers under the
Consultative Group on International Agricultural Research.
http://www.seedquest.com/news.php?type=news&id_article=15232&id_region=&id_category=&id_crop=
Source:
SeedQuest.com
(Return to Contents)
4.02 OWSDW Prizes 2011 for young women scientists in
developing countries (second call)
The 2011 call for applications is open
With the support of TWAS and the Elsevier
Foundation prizes of US$5,000 will be awarded to the best young female
scientists in three categories (biology, chemistry and physics/mathematics)
from each of the four regions of the developing world (Africa, Arab region,
Asia and the Pacific, Latin America and the Caribbean).
See the OWSDW website www.owsdw.org to download the Prize Nomination form
Contact details:
Organization for Women in Science for the
Developing World OWSDW
c/o TWAS - the academy of sciences for the
developing world
ICTP Campus - Strada Costiera, 11 - 34151
Trieste - Italy
(Return to Contents)
4.03 TWAS South-South Fellowships Programme
The Academy of Sciences for the Developing World
(TWAS) is promoting various
fellowship programmes for PhD, Postdoctoral and Advanced Research. These schemes represent a
great opportunity for scientists and
researchers who may be interested in enhancing their scientific knowledge.
The fellowships are overseen jointly by TWAS and
various host institutes in
countries in the South, including Brazil, Pakistan, China and India and they allow scientists from
developing countries to study or do
research in other developing countries and then to return home to
continue their careers.
TWAS Fellowships: 2011 Call for Applications
Postgraduate, postdoctoral, visiting scholar and advanced research fellowships available to scientists
from developing countries
TWAS, the academy of sciences for the developing
world, is now accepting
applications for its postgraduate, postdoctoral, visiting scholars and advanced research fellowship programmes.
The fellowships are offered to scientists from
developing countries and are
tenable at centres of excellence in various countries in the South, including Brazil, China, India, Kenya,
Malaysia, Mexico, Pakistan and
Thailand.
Eligible fields include: agricultural and
biological sciences, medical and
health sciences, chemistry, engineering, astronomy, space and earth sciences,
mathematics and physics.
Women scientists are especially encouraged to
apply.
Mara Marchesan
TWAS Fellowships Office
TWAS, the academy of sciences for the developing
world
The TWAS South-South Fellowships Programme provides
over 300 fellowships each year tenable in developing countries such as Brazil,
China, India, Kenya, Malaysia, Mexico, Pakistan and Thailand for scientists
from developing countries. Fellowships, for various lengths of time, are
available for postgraduate, postdoctoral and advanced research. Brief details
of each programme are provided below. Please see www.twas.org > Programmes > Exchange > Fellowships (http://twas.ictp.it/prog/exchange/fells/fells-overview) for the latest information regarding all these programmes, including
eligibility criteria, deadlines,
etc, and to download the application forms and guidelines.
Fellowships
for Postgraduate Training
TWAS-CNPq Fellowships for Postgraduate Research in
Brazil
The National Council for Scientific and
Technological Development (CNPq) and TWAS offer fellowships for scientists from
developing countries (other than Brazil) who wish to pursue all or part
(SANDWICH or FULL-TIME) of their research leading towards a PhD in the natural
sciences.
Duration: up to 4 years Deadline for applications:
30 June each year Age limit: 35
TWAS-CAS Fellowships for Postgraduate Research in China
The Chinese Academy of Sciences (CAS) and TWAS
offer fellowships for students from developing countries (other than China) who
wish to undertake the final year of their PhD research in the naturalsciences.
Duration: 1 year Deadline for applications: 31
August each year Age limit: 35
TWAS-CSIR Fellowships for Postgraduate Studies in
India
The Council of Scientific and Industrial Research
(CSIR) and TWAS offer fellowships for scientists from developing countries
(other than India) who wish to obtain a PhD in newly emerging areas inscience
and technology. SANDWICH and FULL-TIME fellowships available.
Duration: up to 4 years Deadline for applications:
31 August each year Age limit: 35
TWAS-DBT Biotechnology Fellowships for Postgraduate
Studies in India
The Department of Biotechnology, Government of
India (DBT) and TWAS offer fellowships for scientists from developing countries
(other than India) who wish to obtain a PhD in biotechnology. SANDWICH and
FULL-TIME fellowships available.
Duration: up to 5 years Deadline for applications:
31 August each year Age limit: 30
TWAS-S.N. Bose Fellowships for Postgraduate Studies
in India
The S.N. Bose National Centre for Basic Sciences
(S.N. Bose) and TWAS offer fellowships for scientists from developing countries
(other than India) who wish to obtain a PhD in the physical sciences. SANDWICH
and FULL-TIME fellowships available.
Duration: up to 4-5 years Deadline for
applications: 31 August each year Age limit: 35
TWAS-IACS Fellowships for Postgraduate Research in
India
The Indian Association for the Cultivation of
Science (IACS) and TWAS offer fellowships for scientists from developing
countries (other than India) who wish to obtain a PhD in a field of natural
sciences.
Duration: up to 4 years Deadline for applications:
30 June each year Age limit: 30
TWAS-icipe Fellowships for Postgraduate Research in
Kenya
The International Centre of Insect Physiology and
Ecology (icipe) and TWAS offer fellowships for scientists from developing
countries (other than Kenya) who wish to obtain a PhD in the naturalsciences,
especially focusing on integrated control methodologies for crop and livestock
insect pests and other related arthropods, and insect vectors of tropical
diseases.
Duration: up to 3 years Deadline for applications:
15 September each year Age limit: 35
TWAS-USM Fellowships for Postgraduate Research in
Malaysia
The Universiti Sains Malaysia (USM) and TWAS offer
fellowships for scientists from developing countries (other than Malaysia) who
wish to obtain a PhD in the natural sciences.
Duration: up to 3 years. Deadline for applications:
15 September each year Age limit: 35
TWAS-CONACYT Fellowships for Postgraduate Research
in Mexico
The National Council on Science and Technology
(CONACYT) and TWAS offer fellowships for scientists from developing countries
(other than Mexico) who wish to obtain a PhD in the natural sciences.
Duration: up to 4 years Deadline for applications:
30 June each year Age limit: 30
TWAS-CEMB Fellowships for Postgraduate Research in
Pakistan
The Centre of Excellence in Molecular Biology
(CEMB) and TWAS offer fellowships for scientists from developing countries
(other than Pakistan) who wish to obtain a PhD in molecular biology and
molecular genetics. SANDWICH and FULL-TIME fellowships available.
Duration: up to 4 years Deadline for applications:
30 June each year Age limit: 35
TWAS-ICCBS Fellowships for Postgraduate Research in
Pakistan
The International Center for Chemical and
Biological Sciences (ICCBS) and TWAS offer fellowships for scientists from
developing countries (other than Pakistan) who wish to obtain a PhD in chemical
or biological sciences. SANDWICH and FULL-TIME fellowships available.
Duration: up to 4 years Deadline for applications:
30 June each year Age limit: 35
Fellowships
for Postdoctoral Research
TWAS-CNPq Fellowships for Postdoctoral Research in Brazil
CNPq and TWAS offer fellowships to scientists from
developing countries (other than Brazil) who wishto pursue postdoctoral
research in natural sciences.
Duration: 6 to 12 months Deadline for applications:
30 June each year Age limit: 45
TWAS-CAS Fellowships for Postdoctoral Research in
China
CAS and TWAS offer fellowships to scientists from
developing countries (other than China) who wish to pursue postdoctoral
research in natural sciences.
Duration: 6 to 12 months Deadline for applications:
31 August each year Age limit: 40
TWAS-CSIR Fellowships for Postdoctoral Research in
India
CSIR and TWAS offer fellowships to scientists from
developing countries (other than India) who wish to pursue postdoctoral
research in newly emerging areas in science and technology.
Duration: 6 to 12 months Deadline for applications:
31 August each year Age limit: 45
TWAS-DBT Biotechnology Fellowships for Postdoctoral
Research in India
DBT and TWAS offer fellowships to scientists from
developing countries (other than India) who wish to pursue postdoctoral
research in biotechnology.
Duration: 12 to 18 months Deadline for
applications: 31 August each year Age limit: 40
TWAS-S.N. Bose Fellowships for Postdoctoral
Research in India
S.N. Bose and TWAS offer fellowships to scientists
from developing countries (other than India) who wish to pursue postdoctoral
research in the physical sciences.
Duration: 6 to 12 months Deadline for applications:
31 August each year Age limit: 45
TWAS-IACS Fellowships for Postdoctoral Research in
India
IACS and TWAS offer fellowships to scientists from
developing countries (other than India) who wish to pursue postdoctoral
research in the natural sciences.
Duration: 6 to 12 months Deadline for applications:
30 June each year Age limit: 40
TWAS-icipe Fellowships for Postdoctoral Research in
Kenya
The International Centre of Insect Physiology and
Ecology (icipe) and TWAS offer fellowships for scientists from developing
countries (other than Kenya) who wish to pursue postdoctoral research in the natural
sciences, especially focusing on integrated control methodologies for crop and
livestock insect pests and other related arthropods, and insect vectors of
tropical diseases.
Duration: 6 to 12 months Deadline for applications:
15 September each year
No age limit, but application must be made within 5
years (or less) of obtaining PhD.
TWAS-USM Fellowships for Postdoctoral Research in
Malaysia
USM and TWAS offer fellowships to scientists from
developing countries (other than Malaysia) who wish to pursue postdoctoral
research in the natural sciences.
Duration: 1 to 3 years Deadline for applications:
15 September each year
No age limit, but application must be made within 5
years (or less) of obtaining PhD.
TWAS-CONACYT Fellowships for Postdoctoral Research
in Mexico
The National Council on Science and Technology
(CONACYT) and TWAS offer fellowships to scientists from developing countries
(other than Mexico) who wish to pursue postdoctoral research in the natural
sciences.
Duration: 6 to 12 months Deadline for applications:
30 June each year Age limit: 40
TWAS-CEMB Fellowships for Postdoctoral Research in
Pakistan
CEMB and TWAS offer fellowships to scientists from
developing countries (other than Pakistan) who wish to pursue postdoctoral
research in molecular biology and molecular genetics.
Duration: 6 to 12 months Deadline for applications:
30 June each year Age limit: 45
TWAS-ICCBS Fellowships for Postdoctoral Research in
Pakistan
ICCBS and TWAS offer fellowships to scientists from
developing countries (other than Pakistan) who wish to pursue postdoctoral
research in chemical or biological sciences.
Duration: 6 to 12 months Deadline for applications:
30 June each year Age limit: 45
TWAS-BIOTEC Fellowships for Postdoctoral Research
in Thailand
BIOTEC and TWAS offer fellowships to scientists
from developing countries (other than Thailand) who wish to pursue postdoctoral
research in biotechnology.
Duration: 12 to 24 months Deadline for
applications: 15 September each year
No age limit, but application must be made within 5
years (or less) of obtaining PhD.
TWAS
Fellowships for Research and Advanced Training
TWAS provides travel support for scientists from
developing countries to carry out research at aresearch institution in a
developing country (other than the home country).
Duration: 3-12 months Deadline for applications: 1
October each year No age limit
TWAS-CAS Fellowships for Visiting Scholars in China
CAS and TWAS offer fellowships to scientists from
developing countries (other than China) who wish to pursue advanced research in
the natural sciences.
Duration: 1-3 months Deadline for applications: 31
August each year Age limit: 55
TWAS-icipe Fellowships for Visiting Scholars in
Kenya
The International Centre for Insect Physiology and
Ecology (icipe) and TWAS offer fellowships for scientists from developing
countries (other than Kenya) who wish to pursue advanced research in the
natural sciences, especially focusing on integrated control methodologies for
crop and livestock insect pests and other related arthropods, and insect
vectors of tropical diseases.
Duration: 1-3 months Deadline for applications: 15
September each year Age limit: 55
TWAS-USM Fellowships for Visiting Researchers in
Malaysia
USM and TWAS offer fellowships to scientists from
developing countries (other than Malaysia) who wish to pursue advanced research
in the natural sciences.
Duration: 1-3 months Deadline for applications: 15
September each year Age limit: 55
TWAS Fellowships Office
Contact details:
ICTP campus
Strada Costiera 11
34151 Trieste, Italy
Email: fellowships@twas.org
(Return to Contents)
4.04 Awards
nominations requested from the National Association of Plant Breeders (NAPB)
(USA)
Help us recognize exceptional contributions to
plant breeding by taking a few moments to submit nominations.
Lifetime Achievement Award (distinguished long-term
service to plant breeding)
Early Career Scientist Award (excellence of
early-career performance).
Nomination instructions are the NAPB Web site: http://www.plantbreeding.org/napb/Awards/Awards.html
(Return to Contents)
|
5.01 Job Description: Hot Pepper Breeder (Vegetables Division)-002ED Description Monsanto is seeking a highly motivated
individual to become an integral member of a multidisciplinary, global Hot
pepper breeding team. This is a superb opportunity to manage a
breeding program in collaboration with a large, multidisciplinary global
research team to obtain successful new products. As a breeder you will
have primary responsibilities for the development of new and improved Hot
pepper hybrids and management of the pre-commercial product pipeline for
targeted global market segments. A significant amount of interaction and
collaboration is expected with other pepper breeders, breeding technology,
pathology, foundation/stock seed, technology development, and the commercial
organization. You will also manage design, development, and
implement breeding research projects in collaboration with plant
pathologists, food chemists, breeding technology. You will be directly
responsibility for managing your breeding staff and budget. You will directly interact with the
vegetable breeding, breeding technology, and trait development scientists and
serve as a key member of the technology development pipeline. The
Culiacan, Sinaloa Mexico location is a major vegetable R&D center in
Mexico. This role offers the prospect to work with the world's largest global
agronomic and vegetable breeding organization that possesses state of the art
breeding application tools and analytical platforms. This provides
opportunities for development of novel breeding approaches/methodologies or
the creative application of existing methods for the enhancement of peppers. Responsibilities:
Qualifications Required Skills/Experiences:
Desired Skills / Experience:
Job Research & Development Primary Location Latin America-Mexico-Sinaloa-Los Mochis Organization R&D Americas_51070580 Schedule Full-time |
Visit www.monsanto.com/careers for additional information and opportunities
Contributed by Donn Cummings
Global Breeder Sourcing Lead, Monsanto
(Return to Contents)
6. MEETINGS, COURSES AND WORKSHOPS
New listings may include some program details, while
repeat listings will include only basic information. Visit web sites for additional details.
This section
includes three subsections:
A.
DISTANCE
LEARNING/ONLINE COURSES
B.
COURSES OF
THE SEED BIOTECHNOLOGY CENTER AT UC
DAVIS
C.
OTHER MEETINGS, COURSES AND WORKSHOPS
A.
DISTANCE LEARNING/ONLINE COURSES
Online Graduate Program in Seed Technology & Business
Iowa State
University
http://click.icptrack.com/icp/relay.php?r=48323218&msgid=597705&act=BDP
The Iowa
State University On-line Graduate Program in Seed Technology and Business
develops potential into managerial leadership.
Seed industry
professionals face ever-increasing challenges. The Graduate Program in Seed
Technology and Business (STB) at Iowa State University provides a unique
opportunity for seed professionals to grow by gaining a better understanding of
the science, technology, and management that is key to the seed industry.
The STB
program offers a Masters of Science degree as well as graduate certificates in
Seed Science and Technology and in Seed Business Management. Science and
technology curriculum includes courses in crop improvement, seed pathology,
physiology, production, conditioning, and quality. Business topics include accounting,
finance, strategy, planning, management information systems, and marketing and
supply chain management--including a unique new course in seed trade, policy,
and regulation.
Contact us
today for more information about how you can apply.