PLANT BREEDING NEWS

 

EDITION 222

31 March 2011

An Electronic Newsletter of Applied Plant Breeding

 

Clair H. Hershey, Editor

chh23@cornell.edu

 

Sponsored by GIPB, FAO/AGP and Cornell UniversityÕs Department of Plant Breeding and Genetics

 

-To subscribe, see instructions here

-Archived issues available at: FAO Plant Breeding Newsletter

 

1.  NEWS, ANNOUNCEMENTS AND RESEARCH NOTES

1.01  FAO Director-General urges increase in agricultural investments

1.02  Trio of factors pushing food prices higher, economist says

1.03  A Hybrid Path to Feeding 9 Billion on a Still-Green Planet

1.04  Forty Findings on the Impacts of CGIAR Research 1971–2011

1.05  Bioenergy crops could lower surface temperatures, Stanford University researchers say

1.06  About the National Association of Plant Breeding (USA)

1.07  One-pager on plant breeding from the National Association of Plant Breeders (USA)

1.08  Plant Breeding Academy training has a big impact on career development

1.09  University of Missouri researcher leads new $6.6 million study that could lead to better corn plants

1.10  Iowa State UniversityÕs new plant breeding masterÕs degree to serve career professionals remotely

1.11  Cucurbit breeding activities in Southeast Asia capture attention of seed company representatives

1.12  Pearl millet set for release in India next year

1.13  New rice variety could ease MozambiqueÕs grain supply

1.14  PHILRICE Recommends better rice varieties for irrigated lowland

1.15  Hands-on training for ÒRice Seed ProductionÓ

1.16  Why enhanced cooperation on patent protection is a step towards enhanced innovation

1.17  FAO seed treaty carries hope, addressing country contributions, farmers concerns

1.18  Plant breeders say they have got a new weapon in the war against the illegal use of seeds

1.19  Two Cents: The GMO Debate

1.20  Mexico oks pilot field of genetically modified corn

1.21  Details of EU proposals on GM crops

1.22  Long week ahead for WIPO experts considering treaty on IP and genetic resources

1.23  UN-backed treaty meeting seeks to boost conservation of worldÕs plant varieties

1.24  Rebuild small seed enterprises - Farmers' seed ventures key to food security in developing countries

1.25  Genebanks could be storing the wrong seeds - Dutch study investigates the authenticity of heirloom cultivars stored at genebanks

1.26  Agriculture ministers and senior officials from more than 100 countries commit to review the world crop gene pool

1.27  Study shows how plants sort and eliminate genes over millennia

1.28  U.S. dairy farmer finds unusual forage grass

1.29  The cult of heirloomism

1.30  Genebanks could be storing the wrong seeds

1.31  'Tequila' plants as biofuel crops

1.32  Scientists study diversity between and within farmersÕ tomato varieites from Eritrea

1.33  Flood-tolerant rice plants can also survive drought, say UC Riverside scientists

1.34  Improving rice yield in salty soils

1.35  Molecular marker screening of tomato germplasm for root-knot nematodes resistance

1.36  United Kingdom - BASF launches new canopy assessment tool app for iPhone

1.37  Research finds path to corn smut resistance

1.38  Nuevos resultados genŽticos sobre la calidad del trigo

1.39  Key plant traits yield more sugar for biofuels

1.40  Promising results for breeding drought-resistant cowpea

1.41  Two genes better than one for important plant pest

1.42  Evaluation of the brown planthopper resistance genes in hybrid rice

1.43  Global wheat rust project gets US$40 M support

1.44  Release of insect resistant maize hybrids

1.45  Cient’ficos espa–oles logran plantas resistentes a diferentes virus inhibiendo un œnico gen

1.46  DNA markers for marker-assisted breeding: a brief overview

1.47  Cloned seeds show promise for crop breeding

1.48  Arabidopsis anticipates mildew attack in the morning

1.49  Phytochemicals of Brassicaceae in plant protection and human health – Influences of climate, environment and agronomic practice

1.50  How do plants fight disease?

 

2.  PUBLICATIONS

2.01  New book: ÔBreeding crops with resistance to diseases and pestsÕ

2.02  FAO policy guide: Promoting the Growth and Development of Smallholder Seed Entrprises for Food Security Crops

2.03 New publication on the origin of and centers of diversity of maize in Mexico

 

3.  WEB AND NETWORKING RESOURCES

3.01 Information on seeds from FAO

 

4.  GRANTS AND AWARDS

4.01  Wanted: global rice science scholars

4.02  OWSDW Prizes 2011 for young women scientists in developing countries (second call)

4.03  TWAS South-South Fellowships Programme

4.04  Awards nominations requested from the National Association of Plant Breeders (NAPB)

 

5.  POSITION ANNOUNCEMENTS

5.01 Job Description: Hot Pepper Breeder (Vegetables Division)-002ED

 

6.  MEETINGS, COURSES AND WORKSHOPS

 

7.  EDITOR'S NOTES

 

 

1 NEWS, ANNOUNCEMENTS AND RESEARCH NOTES


1.01 
FAO Director-General urges increase in agricultural investments

 

Abu Dhabi, United Arab Emirates

15 March 2011

FAO Director-General Jacques Diouf today reiterated his call for greater investment in agriculture, using the example of the United Arab Emirates (UAE) investments in date palm development, a program that has made it the seventh date producer in the world, with 6 percent of global date production.

 

The Director-General's comments came at the opening of the third edition of the Khalifa International Date Palm Award, which today awarded prizes to eight winners for excellence in research, techniques, production, cultivation and development. The award is designed to raise awareness of the role of dates in food security.

 

Date palm trees a UAE cultural heritage

"This initiative truly reflects the importance of the date palm in the cultural heritage of the United Arab Emirates and in the food economy of the region", Diouf said, explaining that the sector constitutes a priority for economic diversification in the government's development plan.

 

"However, there is a need to increase the supply of quality plant material for local and regional needs and to go beyond the present framework of date production by Government plantations and a limited number of private farmers," he added.

 

Diouf paid tribute to Sheikh Khalifa Bin Zayed Al Nahyan, saying that the UAE president's commitment to the development of agriculture and, specifically, to the date palm had prompted increased investment in agriculture and a greater use of modern technology.

 

"It was thus possible to obtain an increase in the number of date palms, a multiplication of varieties, and a marked improvement in the marketing and processing of dates", Diouf said.

 

But investment in agriculture still lagging

But the Director-General reminded his audience that, as in 2008, international agricultural markets again face higher food commodity prices that could undermine food security in a world where population, and thus the demand for food, are sharply on the rise.

 

The expected growth in population - from 6.9 billion people today to 9.1 billion in 2050 - will require a 70 percent increase in global food production and a 100 percent increase the developing countries, he said adding that investment was not keeping pace.

 

"The share of agriculture in official development assistance fell from 19 percent in 1980 to 3 percent in 2006. Currently, it stands at 5 percent. Developing countries only allocate 5 percent of their national budgets to the sector, instead of 10 percent, despite its contribution to gross domestic product, exports and the balance of payments", Diouf said.

 

Meanwhile, more than 100 million tonnes of cereals are diverted from food to biofuels on account of subsidies valued at 13 billion US dollars and tariff protection of the developed countries.

 

"If we add the impact of droughts, floods, hurricanes and other events exacerbated by climate change and the speculation on agricultural commodity futures markets, it becomes clear that the current situation is the chronicle of a disaster foretold," he added.

 

The DG commended the UAE for attaching great importance to the agricultural sector despite the country's land and water constraints and thereby pursuing the policy of the UAE's "visionary" leader, the late Sheikh Zayed, who declared "Give me agriculture and I will give you civilization".

 

http://www.seedquest.com/news.php?type=news&id_article=15398&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++

 

1.02  Trio of factors pushing food prices higher, economist says

 

West Lafayette, Indiana, USA

March 11, 2011

 

Grain shortages, Middle East turmoil and extreme weather in critical crop-producing regions have combined to send retail food prices higher this year, said a Purdue University agricultural economist. Prices could climb further if commodities markets continue their upward march.

 

American consumers can expect to spend about 4 percent more for food this year than in 2010, said Corinne Alexander. Beef, pork and poultry products likely will see even greater price hikes, she said.

 

U.S. food price inflation reached 7.5 percent in September 2008 before falling 10.5 percent by November 2009. It's been moving back up ever since.

 

"We're returning to a period of food price inflation after coming off a period where we saw food price deflation," Alexander said. "We don't expect this to be a long-term, permanent higher food price period. We'll see these higher food prices until we rebuild global stocks of the primary crops."

 

Shortages in corn, soybean and wheat stocks have pushed prices to their highest levels this decade. Corn and soybeans are used for food products, animal feed and in biofuels production, while wheat is the principal ingredient in breads and cereals.

 

Since mid-2010, corn futures prices have more than doubled to more than $7 per bushel and could exceed the $7.65 record set in 2008. Soybean prices are up 40 percent from one year ago, to just over $13 a bushel. Wheat futures have risen more than 50 percent since this past July, to $7.75 per bushel.

 

"With higher grain costs, the biggest food inflation price impacts we expect to see are in the livestock area," Alexander said. "Because those feed costs are up, we're expecting beef prices to be up on the order of 5.5 to 6.5 percent in the coming year. Pork prices will be up on the order of 7 to 8 percent. Poultry prices will rise more moderately because it doesn't take near as much grain to get a pound of chicken as it does a pound of pork or beef, so chicken prices will be up about 3 to 4 percent."

 

Oil markets also are affecting food prices. Recent uprisings in Egypt and Libya have sent oil soaring to more than $100 a barrel. Food companies have absorbed some of those price shocks but will have to charge more for their products should oil markets surge higher, Alexander said.

 

"We're in a world today where food companies operate on the assumption that crude oil prices are going to be $85 to $95 a barrel," she said. "Current prices are somewhere around $105 to $110 a barrel."

 

Weather has played havoc with food production, as well. Drought devastated Russia's 2010 wheat crop, leading Moscow to ban wheat exports. Freezing temperatures this winter cut into Mexico's production of tomatoes and bell peppers.

 

Storms have battered the sugar industry, sending prices to more than double what they were in 2009.

 

"Brazil didn't have a great crop," Alexander said. "Add on top of that Australia, the third largest exporter of sugar in the world. Queensland, which is their sugar-growing area, had massive floods and then got hit by a cyclone."

 

Not all the news is bad for consumers. Milk production remains high, despite the poor prices dairy producers are receiving. And the total amount the average U.S. family spends on food continues to be about 10 percent of their take-home income, compared with 40 percent to 50 percent in developing countries such as Bangladesh.

 

"When you see massive food price inflation and food is half of your family's budget, it hurts substantially more," Alexander said.

 

http://www.seedquest.com/news.php?type=news&id_article=15320&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++++

 

1.03  A Hybrid Path to Feeding 9 Billion on a Still-Green Planet

 

By ANDREW C. REVKIN

 

Improvements in crop genetics and wasteful, inefficient farming and food management provide the biggest gains in a plan to triple agricultural production on todayÕs global farm acreage, with the potential shifts displayed above. This vision of a path to feeding roughly 9 billion people with rising living standards, while also limiting deforestation and other damage to ecosystems, comes from Jason Clay, a longtime analyst of the intersection of food and the environment and a senior vice president of the World Wildlife Fund.

 

HereÕs his draft paper on this strategy. The genetic work he describes includes all uses of genetic research to improve plant productivity or farming efficiency. Genetic modification, the realm of the GMOÕs that are anathema to some environmentalists and much of Europe, is a subset of that arena. [At the Climate, Mind and Behavior Conference of the Garrison Institute on Thursday, Clay laid out the logic behind working with big corporations to foster food production that can fit on a finite planet. He made a point that  he stressed at the recent annual meeting of the American Association for the Advancement of science: "In the next 40 years we're going to have to produce as much food as was produced in last 8,000."]

 

ClayÕs work builds in part on the research of Jon Foley, the director of the Institute of the Environment at the University of Minnesota. I encourage you to review FoleyÕs argument for a resilient hybrid strategy. HereÕs how he put it in an interview with Earth & Sky:

 

I think we need a new kind of agriculture – kind of a third agriculture, between the big agribusiness, commercial approach to agriculture, and the lessons from organic and local systemsÉ. Can we take the best of both of these and invent a more sustainable, and scalable agriculture? [Read, and hear, his answer..]

 

HereÕs a bigger question. Given the glaring yield gaps between rich and poor places, particularly, can campaigners and citizens passionate about environmental conservation (and ÒgreenÓ eating) learn to embrace the need, in many crops and situations, for intensification as a path to a greener, thriving world?

 

Read this piece in Nature on http://www.nature.com/news/2010/100728/full/466542a.html on the growing debate within Europe about the potential costs to that region in lost innovative capacity in agriculture if its barriers to genetic work persist:

 

Some farmers have also criticized the proposal, fearing that it will drive investment in agrobiotech away from Europe and make their industry less competitive. ÒThis decision sends a clear signal to the rest of the world that the EU lacks interest in innovation and new technologies for a competitive agriculture industry and that it does not use evidence and science in its decision-making,Ó the UK National Farmers UnionÕs chief science and regulatory affairs adviser, Helen Ferrier, said in a statement. ÒThe very real danger is that it risks discouraging technology companies investing in Europe.Ó

 

Meanwhile, environmental groups such as Friends of the Earth and Greenpeace are concerned that devolving decision-making on GM crops will make it more difficult to block their development.

 

My guess is that EuropeÕs resistance will fade as China pushes ever harder and as African countries, particularly, begin to recognize the gains — where they fit — from these technologies.

 

Contributed by Rodomiro Ortiz

 

(Return to Contents)

 

++++++++++++++++++++++

 

1.04  Forty Findings on the Impacts of CGIAR Research 1971–2011

 

The collaborative work of the Consultative Group on International Agricultural Research (CGIAR) has resulted in development impacts on a scale that is without parallel in the international community. They are the result of Òinternational public goods,Ó including improved crop varieties, better farming methods, incisive policy analysis and associated new knowledge. These products are made freely available to national partners, who transform them into locally relevant products that respond effectively to the needs of rural households in developing countries. Following are 40 largely quantitative findings on CGIAR impacts since its inception in 1971. Most were gleaned from a 2010 Food Policy journal article authored by Mitch Renkow of North Carolina State University in the USA and Derek Byerlee, a former adviser in the World BankÕs Agriculture and Rural Development Department and co-author of the World Development Report 2008: Agriculture for Development. The article provides a quite comprehensive overview of hard evidence published in the last decade on CGIAR research impacts.

 

Much of this impact has resulted from collaborative research on crop improvement, whose products figured so importantly in the Green Revolution and in subsequent efforts to extend the initial gains in agricultural productivity.

 

1 As a result of crop improvement research within and beyond the CGIAR, 65 percent of the total area planted to the worldÕs 10 most important food crops is sown to improved varieties.

 

2 About 60 percent of the food crop area planted to improved varieties is occupied by many of the approximately 7,250 varieties resulting from CGIAR research.

 

3 A 2008 study put the overall annual economic benefits of CGIAR research on the three main cereals alone at about US$0.8 billion for maize, $2.5 billion for wheat and $10.8 billion for rice in Asia alone, far exceeding the investment in this work.

 

4 For these three crops, research on genetic improvement has made possible rates of yield growth that vary in recent years from 0.7 to 1 percent annually.

 

5 According to a 2008 study on potato improvement, varieties originating from the CGIAR are now planted to more than 1 million hectares, double the area documented just 5 years before.

 

6 The estimated rates of return on the CGIARÕs investment in all crop improvement research range from 39 percent in Latin America to more than 100 percent in Asia and in the Middle East and North Africa. For small-scale farmers, the appeal of improved crop varieties lies not just in their higher yields but in their resistance to diseases and pests and their adaptation to physical stresses like drought, traits that translate into more stable yields over time.

 

7 Recent research documents a steady decline in the variability of maize and wheat yields over the last 40 years, which is statistically associated with the spread of more stress-resistant varieties.

 

8 More stable maize and wheat yields generate benefits with an estimated annual value of US$149 million and $143 million, respectively, more than the total amounts spent annually on maize and wheat breeding for the developing world.

 

9 Research aimed at maintaining resistance to a single major disease of wheat — leaf rust — generated benefits from 1973 to 2007 that are currently worth $5.4 billion.

 

10 A 2009 study aimed at quantifying benefits from CGIAR research on yield stability estimated that the global economic value of genetic resistance to various wheat diseases amounts to as much as $2.0 billion annually. Diseases also pose a major threat to livestock production. Solutions, such as vaccines, are now being rolled out and could generate large impacts.

 

11 The production and delivery of a vaccine for East Coast fever — a tick-transmitted disease that threatens some 25 million cattle in 11 countries of eastern, central and southern Africa — is being placed in the hands of private sector partners. It is expected to save more than a million cattle, with benefits worth up to US$270 million a year in the countries where the disease is now endemic.

 

 

As the impacts of climate change emerge, including more frequent and severe drought and flooding, CGIAR crop improvement research is developing new and more resilient generations of cereal varieties:

 

12 More than 50 new varieties with drought tolerance have been adopted on a total of about 1 million hectares across eastern and southern Africa, giving an average yield advantage of 20-50 percent. A 2010 study projects that further adoption of these maize varieties could boost harvests in 13 African countries by 10-34%, generating up to US$1.5 billion in benefits for producers and consumers.

 

13 A novel approach to seed dissemination has put a new rice variety in the hands of 100,000 Indian farmers within one year after its release in 2009. The new variety offers a yield advantage of 1 ton per hectare, even if submerged for 2 weeks, making it an attractive option for IndiaÕs 12 million hectares of flood-prone agricultural land.

 

 

A landmark 2003 study on the impact of crop improvement research from 1965 to 1998 painted a counterfactual scenario of what the global food system would be like without CGIAR research. It concluded that:

 

14 Developing countries would be producing 7-8 percent less food.

 

15 Their cultivated area would be 11-13 million hectares greater at the expense primary forests and other fragile environments.

 

16 Their per capita food consumption would be 5 percent lower, on average.

 

17 Some 13-15 million more children would be malnourished.

 

18 The study also noted that for every US$1 dollar invested in CGIAR research, $9 worth of additional food is produced in developing countries.

 

 

Precisely because major impacts can be realized only through collaborative research, the CGIAR has made a considerable effort over the years (accounting for roughly 20 percent of its expenditures) to strengthen the capacity of national partners through formal and informal training as well as other learning activities.

 

19 An estimated 80,000 professionals have received such training so far. According to an external evaluation carried out in 2006, this work is highly relevant to national capacity needs and of high quality, judging from the results of trainee surveys. Evidence from seven country case studies suggests that CGIAR training is a Òsignificant contributor to positive outcomes from research.Ó

 

 

In addition to improving all of the worldÕs major food crops, CGIAR researchers have achieved, for the first time ever, dramatic productivity gains in a tropical food fish.

 

20 Selective breeding of the Nile tilapia resulted in a highly productive strain that grows faster and survives better than local ones, offering yields that are 25 to nearly 80 percent higher in the five Southeast Asian countries where the Òsuper tilapiaÓ was introduced and evaluated during the mid-1990s. In all of these countries, the new strain has generated additional income and employment on both large- and small-scale fish farms, while lowering market prices by about 10 percent and thus benefiting consumers significantly. In the Philippines alone, increased employment in the tilapia industry has benefited 300,000 people.

 

 

A large amount of evidence compiled since the 1990s indicates that gains in developing country food production have contributed importantly to poverty reduction by raising farm incomes, creating employment for farm workers, reducing the price of food and fueling economic growth.

 

21 A 2007 study showed that CGIAR research on rice enabled more than 6.75 million Chinese to escape poverty between 1981 and 1999, primarily as a result of lower grain prices made possible by increased crop production.

 

22 The poverty reduction numbers for India are even more impressive — 14 million people moved out of poverty between 1991 and 1999. Several studies published in recent years have documented the impacts of the CGIAR as a whole either at the global level or in specific regions.

 

23 The economic benefits of the CGIAR as a whole were estimated to range from about US$14 billion to more than $120 billion. Even under quite conservative assumptions, the benefits of research have been roughly double the investment.

 

24 A 2007 review of investments in agricultural research carried out by five CGIAR Centers and their partners in South Asia during the post-Green Revolution period (i.e., since the early 1980s) found average annual benefits of more than $1 billion from research on maize, rice and wheat alone, far above the CGIARÕs total annual expenditures in the region.

 

 

CGIAR research has had less impact in Africa than in Asia, but work in the former region began a decade later and under quite difficult conditions. Even so, a number of impact studies suggest that African agriculture can produce successes on a par with those unfolding elsewhere, delivering large returns on the CGIARÕs significant investment in the region.

 

25 In the late 1980s, Africa witnessed one of the CGIARÕs most spectacular research achievements since the Green Revolution — biological control of two devastating insect pests of the tropical root crop cassava. The economic returns — reaching a current value US$9 billion for research on just one of the pests, the cassava mealybug — far exceed the CGIARÕs total investment in Africa since 1971.

 

 

Crop research has yielded important results in Africa as well.

 

26 As a result of maize improvement in West and Central Africa from 1971 to 2005, farmers are planting improved varieties, derived mostly from CGIAR research, on about 60 percent of the total maize area, with economic benefits estimated at $2.9 billion annually.

 

27 Improved varieties of cowpea, which provide both food and livestock feed, are being widely adopted in the dry savannas of West Africa, with estimated benefits of $299 million to $1.1 billion expected to accrue during 2000-2020.

 

28 Impressive gains have also been registered in Eastern and Southern Africa, where improved varieties of common bean, developed with farmer participation, have been adopted on about 50 percent of the total bean area over about 15 years, according to a 2008 study. It estimates that the new varieties are strengthening food security and raising incomes in 5.3 million rural households. The benefits of bean improvement research for Africa are estimated to have a current value of roughly $200 million, compared to costs of about $16 million.

 

29 New Rice for Africa, or NERICA, which combines the high yields of Asian rice with African riceÕs resistance to local pests and diseases, has spread to about 250,000 hectares in upland areas, helping reduce national rice import bills and generating higher incomes in rural communities.

 

30 Recent research has also begun to document nutritional benefits from improved crop varieties. In Mozambique, the introduction of new orange-fleshed sweet potato significantly increased the intake of vitamin A among young children in 850 households, according to a 2007 study.

 

 

The results of CGIAR research on natural resource management have proved harder to implement and evaluate than its work on crop improvement. Nonetheless, a set of seven case studies published in 2007 indicates that this research is giving highly positive returns on investment, based just on the benefits for agricultural productivity. If methodologies were available for gauging the environmental benefits as well, the returns would no doubt be much higher.

 

31 The practice of no-tillage, which is spreading rapidly in the rice-wheat systems of South AsiaÕs Indo-Gangetic Plain, has been shown to reduce farmersÕ production costs by 10 percent and to raise crop productivity by the same amount, generating economic benefits on the order of US$165 million since 1990. This does not include the substantial environmental gains resulting from the conservation of water, sequestration of carbon in the soil and reduction of greenhouse gas emissions.

 

32 By 2002, more than 66,000 farmers in Zambia had adopted an agroforestry system called Òfertilizer tree fallows,Ó which renews soil fertility using on-farm resources. The system has been shown to boost maize production while reducing production risks and soil erosion, with benefits of up to $20 million, compared with an investment of about $3.5 million.

 

33 In Malawi, an integrated agriculture-aquaculture system, introduced during the mid-1990s with active farmer participation at a cost of $1.5 million, has created benefits worth nearly $3.5 million by doubling the income of rural households and dramatically increasing fish consumption. The system shows great promise for other areas of southern Africa where the agricultural labor force has been devastated by HIV/AIDS.

 

34 New information and tools provided to conservationists during the 1990s is being used to monitor some 37 million hectares of forest globally, resulting in better management of this diminishing resource and contributing to more sustainable livelihoods for forest dwellers.

 

 

Development impact depends not just on new technologies but on better policies that offer rural people the means and incentives to invest in sustainable agricultural production and resource use. While hard to measure, the impacts of CGIAR policy research and advocacy appear to be substantial, as suggested by recent case studies indicating benefits worth millions of dollars.

 

35 Research on the liberalization of rice prices in Vietnam during the mid-1990s led to the relaxation of rice export quotas and of internal restrictions on trade, generating benefits worth US$45-91 million.

 

36 A food-for-education program in Bangladesh, catering to 2.1 million students in 17,811 schools, created total benefits estimated at $248 million, with the aid of capacity building and policy research, which guided the conception, evaluation and targeting of the initiative starting in the early 1990s.

 

37 Recent work on the political economy of IndonesiaÕs pulp and paper sector has given rise to more sustainable production practices, more effective regulation and other interventions, with benefits totaling $19-21 million.

 

38 Shifts in SyriaÕs policies on fertilizer distribution and barley prices in arid zones starting in the mid-1980s have contributed to increased barley output through more efficient fertilizer use, leading to improved livestock nutrition, with benefits worth $73.4 million.

 

39 Research and advocacy aimed at decriminalizing the marketing of milk by small-scale vendors in Kenya created benefits for producers and consumers having an estimated value of $44-283 million.

 

40 In the Philippines, improved policies on pesticides — starting in the late 1980s and involving the regulation of highly toxic products on rice and the training of rural health officers — has resulted so far in benefits valued at $117 million.

 

http://cgiar.org/pdf/Forty-findings-CGIAR%20_March2011.pdf

 

Contributed by Rodomiro Ortiz

 

(Return to Contents)


+++++++++++++++++++++++

 

1.05  Bioenergy crops could lower surface temperatures, Stanford University researchers say

 

Stanford, California, USA

March 10, 2011

Concerns about the impact of corn ethanol on global warming have raised interest in more eco-friendly perennial grasses. A new study finds that large-scale cultivation of perennials could actually reduce regional surface temperatures.

Converting large swaths of farmland to perennial grasses for biofuels could lower regional surface temperatures, according to a recent Stanford study.

 

The study, published online in the Feb. 28 edition of the Proceedings of the National Academy of Sciences (PNAS), comes on the heels of federal initiatives to wean the United States off fossil fuels by mandating significant increases in ethanol production. The Department of Agriculture forecasts that by 2018, more than one-third of the country's corn harvest will be used to produce ethanol.

 

But concerns about the impact of corn ethanol on food prices, deforestation and global warming have raised interest in the cultivation of perennial grasses – such as switchgrass – as alternative sources of biofuel. Previous studies suggest that ethanol made from switchgrass emits less carbon dioxide than corn-derived ethanol and would therefore have less of an impact on global warming.

 

In the PNAS study, researchers found that widespread cultivation of perennial grasses could actually reduce the surface temperature of Earth at a regional scale.

 

"We've shown that planting perennial bioenergy crops can lower surface temperatures by about 2 degrees Fahrenheit [1 C] locally, averaged over the entire growing season," said study co-author David Lobell, assistant professor of environmental Earth system science and a center fellow at Stanford's Program on Food Security and the Environment. "That's a pretty big effect, enough to dominate any effects of carbon savings on the regional climate."

 

In the study, Lobell and his colleagues used a computer simulation to forecast the climatic effects of converting farmland in the Midwest from annual crops – like corn and soybeans – to perennial grasses. The results showed that large-scale perennial cultivation in the 12-state area would pump significantly more water from the soil to the atmosphere, producing enough water vapor to cool the local surface temperature by 1.8 F.

"Locally, the simulated cooling is sufficiently large to partially offset projected warming due to increasing greenhouse gases over the next few decades," the authors wrote.

 

"A key issue remaining is whether the additional water being pumped from the soil gets fully replenished by rainfall, or whether in the long term the soil dries and can't support the same amount of crop production," Lobell said.

 

"More study is needed to understand the long-term implication for regional water balance," added lead author Matei Georgescu of the Center for Environmental Fluid Dynamics at Arizona State University. "This study focused on temperature, but the more general point is that simply assessing the impacts on carbon and greenhouse gases overlooks important features that we cannot ignore if we want a bioenergy path that is sustainable over the long haul."

 

The PNAS study was also co-authored by Chris Field, professor of environmental Earth system science and of biology at Stanford. Field is also a senior fellow at Stanford's Woods Institute for the Environment and director of the Carnegie Institution's Department of Global Ecology. The research was made possible through support from the Stanford Global Climate and Energy Project and a National Science Foundation grant at Arizona State University.

 

The Program on Food Security and the Environment is a partnership of the Woods Institute for the Environment and the Freeman Spogli Institute for International Studies at Stanford.

 

http://www.seedquest.com/news.php?type=news&id_article=15371&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++++

 

1.06  About the National Association of Plant Breeding (USA)

 

NAPB is primarily focused on US-relevant plant breeding issues.  NAPB now has over 900 members, and continues to expand rapidly.  These members are professionals, staff, students, public, philanthropic, commercial, domestic and international, and work on all sorts of plants and plant breeding topics. To join NAPB (no cost), see our NAPB website, or send an email to David Stelly (NAPB Secretary) with "NAPB - REQUEST TO JOIN".   \The Plant Breeding Coordinating Committee is an advisory group on plant breeding in the US.

 

NAPB Website:

Have you seen our re-designed website?  We need to thank Seth Murray for this. The NAPB website is the focal point of plant breeding activities with highlights on what the NAPB and PBCC can do for you (About), Hot Topics, Meetings, Awards, Careers, including links to jobs through Associations and Seedquest and free resume posting; links to Plant Breeding programs in the US and partners.  Please visit National Association of Plant Breeders (http://www.plantbreeding.org) and feel free to provide us with any information to keep our website relevant.

 

Education:

The education committee has been working hard to build capacity to develop educational information (see links, careers and hot topics) and keep our members updated on the latest educational opportunities such as courses. Examples include Illinois Corn Breeders School, Plant Breeding Academy and links to websites such as the USDA extension website on Plant Breeding and Genomics. Additionally, the first journal article from the UC Davis Delphi study, "Designing graduate level plant breeding curriculum: A Delphi study of private sector stakeholder opinions", was accepted for publication in the Journal of Natural Resources and Life Sciences Education.  For more information regarding the article please visit http://sbc.ucdavis.edu/education/delphi_study.html.  Please help us keep up-to date on any further plant breeding education activities. Please help us keep up-to date.

 

Source: Excerpted from Newsletter 1, March 17, 2011 by the editor, PBN-L)

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.07  One-pager on plant breeding from the National Association of Plant Breeders (USA)

 

Our one-pager on sustaining plant breeding has been posted on the NAPB website at:

 

Plant Breeding: It's a Journey, Not a Destination

 

(EditorÕs note: figures excluded from the following version)

 Food and fiber for an ever-increasing world population

The worldÕs population continues to increase, doubling from 3 to 6 billion between 1960 and 1999. By 2050, the number of humans is expected to exceed 9 billion. Providing food and fiber for this enormous population is an ominous challenge facing humankind, without significant addition of new arable lands, challenges of changing weather patterns, and decreased quantity and quality of fresh water. Genetic selection by plant breeders brought about the ÔGreen RevolutionÕ of the 1960s and 1970s that increased production of major crops and saved millions in the developing world from starvation. Plant breeders continue this success story by developing superior crops to meet the world needs for food, fiber, and fuel.

 

Plant Breeding: Continuous investment pays continuous dividends

Plant breeding is never complete. Long-term support of plant breeding is the major reason why the USA still leads the world in agriculture, fueling economic growth, new businesses, and new jobs. TodayÕs high-quality, superior-yielding crops are the foundations of even better plants for tomorrow. However continuous increases in crop productivity and quality are directly tied to sustained investment in plant-breeding personnel and infrastructure, such as research stations, greenhouses, labor and materials for crossing and selection, etc. Examples for which long-term investment in plant breeding have paid off handsomely include:

 

Plant breeders rely on sustained funding for long-term selection of crops to address such challenges as:

á Increased global trade introducing exotic pests or pathogens;

á Higher mean temperatures and humidity making endemic diseases and

pests more serious;

á Drought and reduced access to fresh water contributing to significant yield

reductions;

á Increasing input costs for fuels and fertilizers.

 

Recommendations:

Sustained funding of plant breeding by commodity groups, private industries, USDA, and other state or federal agencies to:

á Support the infrastructure and long-term commitment required to develop superior crops for US production and global consumption;

á Train the next generation of plant breeders to address the needs of a growing  world population with fewer inputs and decreasing arable land.

 

For more information:

Please visit the website of the National Association of Plant Breeders (NAPB) at http://www.plantbreeding.org/napb/sustainingplantbreeding.html

 

Mike Havey

Vice-Chair of PBCC

University of Wisconsin

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.08  Plant Breeding Academy training has a big impact on career development

 

Davis, California, USA

March 15, 2011

A recent survey of UC Davis Plant Breeding Academy (PBA) graduates shows that the program has a significant impact on both the employer and the graduate-employee. Graduates from the first two classes were surveyed with three statements measuring the impact of PBA on: 1) the contribution the graduates make to their organizations and 2) recognition they have received for their contributions. The graduates enthusiastically participated in the survey with more than 50% of them mailing in responses within the first 3 days of our inquiry.

 

Eighty-nine percent of respondents agree or strongly agree that they have become more productive employees in their respective organizations; 72.2% of respondents agree or strongly agree that the complexity of their tasks and duties have increased as a result of PBA training; more than 55% of the respondents experienced positive career changes in terms of promotion and salary.

 

Dr. Rale Gjuric, Education Director, Seed Biotechnology Center, UC Davis reflects on the results of the survey and success of the program: ÒIt is great to confirm that our graduates and their employers are benefiting from the training received through the PBA. It gives us a The UC Davis Plant Breeding Academy is a postgraduate program that teaches the fundamentals of plant breeding, genetics and statistics through lectures, discussion, and field trips to public and private breeding programs. Employers appreciate the opportunity to provide their valued employees advanced training without disrupting their full-time employment. Participants attend six 6-day sessions over the period of two years. The instructors are internationally recognized experts in plant breeding and seed technology. great satisfaction and sense of purpose. The recognition by the employers is another measure of industry satisfaction with the program. The European PBA Class I and PBA Class III are currently in progress, adding thirty more graduates by the end of 2012. With the success of the European program and anticipated expansion to Asia, we expect to have a total of over 100 PBA graduates by 2014.Ó

 

http://www.seedquest.com/news.php?type=news&id_article=15414&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.09  University of Missouri researcher leads new $6.6 million study that could lead to better corn plants

 

Columbia, Missouri, USA

March 14, 2011

Plants harvest energy through the process of photosynthesis, using sunlight to produce sugars. However, little is known about the genes that regulate the transport of sugars to build different parts of the plant. Now, a University of Missouri researcher has received a $6.6 million grant from the National Science Foundation to lead a research team to study the genes that control the movement of carbohydrates in corn. This research may lead to increased yield, more drought resistant plants, larger plants and easier production of biofuels.

 

ÒWhen corn produces carbohydrates in the leaves, it transports sucrose, a type of sugar, to other parts of the plant, including the ears and roots,Ó said David Braun (photo), an associate professor in the Division of Biological Sciences in the College of Arts and Science and a member of the MU Interdisciplinary Plant Group. ÒBy understanding how the movement of carbohydrates is regulated, we may be able to engineer plants that better meet the needs of farmers and consumers.Ó

 

Braun said that the carbohydrate transport process for corn is similar to a highway system. Sucrose produced in leaves travels Òdown the roadÓ toward an eventual exit, but it has points where the traffic does not flow properly and the Òexit ramp trafficÓ backs-up into the roadway. Braun plans to find these bottlenecks, so future research can focus on increasing traffic flow towards these Òexit ramps,Ó such as the root system or ears of the plant. Getting more energy to these plant organs may enable the plant to grow larger or hardier.

 

In the future, researchers may be able to use this knowledge to engineer plants with certain qualities. For example, researchers could attempt to improve carbohydrate flow to ears to increase yield, or to the roots to make the plant more drought resistant.

 

ÒCarbohydrate transport is one of the least understood but most important factors in plant development,Ó Braun said. ÒThis research has the potential to have a great effect on corn farming, not just for increasing yield, but on so many other aspects.Ó

 

Braun thinks this research also may enhance the production of biofuels. In addition to carbohydrates being transported throughout the plant for growth, some sugar is converted to cellulose, an organic compound that comprises the plant cell walls. Cellulose is more difficult for processers to convert into biofuel than sucrose. Braun thinks this research may indicate ways that plants could be modified to store more of the carbohydrate as sucrose. With more sucrose in the plant, biofuels could become cheaper to produce and consumers might experience lower prices, leading to increased use.

 

Braun leads a team of researchers from the University of Florida, Purdue University, the University of Nebraska-Lincoln, and St. MichaelÕs College in Vermont. Funding for the project was provided by a grant from the Plant Genome Research Program of the National Science Foundation.

 

http://www.seedquest.com/news.php?type=news&id_article=15455&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.10  Iowa State UniversityÕs new plant breeding masterÕs degree to serve career professionals remotely

 

Ames, Iowa, USA

March 16, 2011

Plant breeders from around the world will soon have access to an advanced degree in their field though a new distance learning Master of Science program offered through the agronomy department at Iowa State University.

 

The program, believed to be the first of its kind, will be available this fall and is designed for plant breeding professionals who want to advance their careers, said Thomas LŸbberstedt (photo), professor, K.J. Frey Chair in agronomy and director of the program.

 

ÒWe started developing the courses after meeting with breeding companies, both large and small, to find out if a program like this was needed,Ó said LŸbberstedt.

 

ÒWe have designed the program with studentsÕ needs in mind,Ó he added.

 

Even before the first student takes a course, research has been done on those needs.

 

ÒSponsored by the USDA, we started the whole thing with a survey sent to plant breeding companies,Ó said LŸbberstedt. ÒThis allowed us to learn what they want, and also let them know that this would soon be available.Ó

 

Survey feedback led to the development of the program that consists of 12 courses and a creative component.

 

Requirements for the Master of Science in plant breeding could be completed in as little as two years, but most students will probably take four or five years, because they are likely to be working professionals, said LŸbberstedt.

 

ISU will continue to offer the on-campus version of the degree.

 

The distance learning plant breeding program is patterned after the very successful distance Master of Science in agronomy program the department launched in 1997. That program has grown to more than 155 active students and has conferred 79 advanced degrees.

 

Potential students have shown a similar high level of interest in the plant breeding program even though it isnÕt officially launched yet, said LŸbberstedt.

 

Janika Eckert, co-owner and plant breeder for JohnnyÕs Selected Seeds in Maine, is eager to start her masterÕs in the new ISU program.

 

ÒMostly, what interests me about continuing education is the opportunity to improve myself, my capabilities and my job performance,Ó she said. ÒBy this, I mean that I hope to breed more and better varieties for our customers.Ó

 

Offering the plant breeding courses through a distance education format presented unique challenges, said LŸbberstedt.

 

ÒThere was some debate about offering this course where students are expected to work with plants in the field,Ó he said. ÒBut because most of these students will already be employees of plant breeding companies, they have substantial field experience.Ó

 

Getting the coursework remotely will also be helpful to potential students such as Jasmine Lopez of Fort Myers, Fla., an assistant plant scientist at Syngenta.

 

Ò[ItÕs a] great program for working professionals who want to develop their career and at the same time want to go back home at night to see their family,Ó Lopez said.

 

According to the ISU agronomy website, plant breeding is the science and art of improving crop plants through the study and application of genetics, agronomy, statistics, plant pathology, entomology, and related sciences.

 

http://www.seedquest.com/news.php?type=news&id_article=15459&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.11  Cucurbit breeding activities in Southeast Asia capture attention of seed company representatives

 

Tainan, Taiwan

March 11, 2011

Source: Newsletter of the AVRDC, The World Vegetable Center

 

D.A.A. Deshpande and M.K. Pande of JK Agri Genetics Ltd., a member of the Asia Pacific Seed Association (APSA), visited AVRDCÕs Regional Office for East and Southeast Asia on 23 February 2011 to discuss opportunities for research collaboration.

 

The visitors were particularly impressed with AVRDCÕs pumpkin and bitter gourd breeding activities, led by cucurbit breeder Narinder Dhillon.

 

Drs. Deshpande and Pande also toured Kasetsart UniversityÕs (KU) tomato and chili fields together with Krung Sitadthani, a vegetable breeder from KUÕs Tropical Vegetable Research Center (TVRC).

 

Full article

 

http://www.seedquest.com/news.php?type=news&id_article=15323&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++++++

 

1.12  Pearl millet set for release in India next year

 

Micronutrient deficiency is very rampant in the undernourished populations of South Asia. This is the reason why HarvestPlus and its partners are continuously developing the nutrient contents of staple crops commonly eaten by the poor. In 2012, high-iron pearl millet, the first biofortified crop, will be released in India. According to reports, 70% of children below 5 in states of Rajasthan, Maharashtra, Gujarat, and Uttar Pradesh where pearl millet is a staple food, are anemic due to lack of iron intake.

 

"These will be higher yielding and will also have a high iron content," says Dr. Kedar Rai, Director of the HarvestPlus India Biofortification Program. This will not just boost the income of farmers, but also improve the health condition of their families.

 

High-zinc varieties of rice and wheat are also being developed and scheduled for release in 2013.

 

Read more at http://www.harvestplus.org/content/pearl-millet-set-release-2012

 

Source: Crop Biotech Update 11 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++++++

 

1.13  New rice variety could ease MozambiqueÕs grain supply

 

A new rice variety will soon benefit farmers in Mozambique. This new rice variety technically known as IR80482-64-3-3-3 and developed by scientists at the International Rice Research Institute, were sent to Mozambique for testing. Results showed that the average yield is seven tons per hectare, which is 95 percent higher than the present varieties planted in the country. It also exhibited better resistance to diseases such as fungal blast and bacterial blight, which is a relief to small farmers who cannot afford to purchase commercial pesticides.

 

The new rice variety has been approved by the registration and release committee at Mozambique's Ministry of Agriculture in December 2010 and will be forwarded to IIAM's seed office for reproduction before delivery to factories for certification and distribution to farmers.

 

Read more at http://allafrica.com/stories/201102141280.html

 

Source: Crop Biotech Update 18 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.14  PHILRICE Recommends better rice varieties for irrigated lowland

 

The Philippine Rice Research Institute (PhilRice) is promoting new high yielding rice varieties with maximum yield potential of 9-12 tons per hectare (t/ha), which has a 1t/ha advantage over the previously bred varieties. These new varieties that are best suited for irrigated lowlands include NSIC Rc212 (Tubigan 15), Rc214 (Tubigan 16), Rc216 (Tubigan 17), Rc222 (Tubigan 18), Rc224 (Tubigan 19), and Rc226 (Tubigan 20). Registering better performance than the check varieties, PSB Rc82 and PSB Rc18, NSIC Rc212 and NSIC Rc214 could yield up to 10 t/ha when transplanted and have an average yield of 6 t/ha. These varieties are bred to help farmers increase their production.

 

For more information regarding these new varieties, visit http://www.philrice.gov.ph/index.php?option=com_content&task=view&id=1251&Itemid=1

 

Source: Crop Biotech Update 11 March 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++

 

1.15  Hands-on training for ÒRice Seed ProductionÓ

 

Bagamoyo, Tanzania

7-10 March, 2011

 

IRRI regional office based at Dar-es-Salaam, Tanzania organized a hands-on training for Ôrice seed productionÕ at IRRI research farm, Bagamoyo from 7 to 10 March 2011, especially for the researchers from eastern and southern Africa (ESA). Logistics of the training was funded by Japan Rice Breeding Project (JRBP) while travel component was supported by the parent organization of the candidates. Training involved 20 participants including 4 female candidates, mostly researchers and few extensionists form public and private organisation from Rwanda, Burundi, Ethiopia, Uganda, Mozambique and Tanzania. The training course content included Rice morphology for clear understanding of the plant while identifying the off-types, nursery raising and management, transplanting of the seedlings, concept of panicle to row for nucleus and breeder seed production, observations and rouging of the commercial seed plots and critical stages, and harvesting and post-harvesting operations and labelling. This training involved minimal classroom presentation and maximum field work. Participants enjoyed working in field on their own as we provided them the practical learning materials at different growth stages using staggered plantings.  Dr. RK Singh, senior scientist and regional plant breeding coordinator for ESA was the course coordinator while Dr. Zak Kanyeka, regional training coordinator for ESA, coordinated the training activities. Dr. YP Singh, consultant (crop production), Mr. Mohammed Mkuya, researcher and Dr. Rosemary Mutegi-Murori acted as facilitator for this training activities. 

 

Contributed by R.K. Singh

Senior Scientist (Regional Plant Breeding Coordinator for Eastern and Southern Africa),

IRRI-AfricaRice Office, Mikocheni B,

r.k.singh@cgiar.org

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.16  Why enhanced cooperation on patent protection is a step towards enhanced innovation

 

Brussels, Belgium

10 March 2011

EuropaBio believes the adoption today of the Competitiveness Council conclusions in favour of an enhanced cooperation procedure in the area of the creation of a unitary patent protection system is an important step in the right direction towards truly supporting innovation and value creation in Europe.

 

Commenting on the development, Tom Saylor, Chair of EuropaBioÕs SME Platform said: ÒOur highly innovative companies, large and small alike, compete on the global scene and are confronted with increasingly high costs of patenting under the current system in Europe. In order for it to remain attractive for innovative companies such as ours to develop and flourish in Europe, these patent costs must come down and Europe must agree on a competent centralized court of patent adjudication. We need to create the right environment in Europe to compete with other high-tech regions in the world so that our companies chose Europe to market the products that help citizens lead longer, healthier and greener lives.Ó

 

The European biotech industry pioneers breakthroughs in research and development in key strategic fields to satisfy unmet medical needs and to provide more sustainable agricultural and industrial products and processes for future generations. The work of these sectors must be enabled if Europe is to realise the value of its strong scientific base through the commercialisation of the products of European biotech and to retain the benefits, value and employment in the EU.

 

Nathalie Moll, Secretary General of EuropaBio, concluded: ÒWe are encouraged by the Ministers agreement on an enhanced cooperation procedure which represents a step in the right direction towards achieving the three core goals set out by the EU 2020 Strategy. We now urge the European Institutions and member states to ensure that the jurisdictional regime is addressed as soon as possible to make enhanced cooperation an operational success. We must also not forget that in the meantime, the ratification of the London Agreement1 by Member States should continue to be a priority. Ó

 

- Council of the European Union press release

- Background: Towards a unitary patent protection in Europe

 

http://www.seedquest.com/news.php?type=news&id_article=15295&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.17  FAO seed treaty carries hope, addressing country contributions, farmers concerns

 

Geneva, Switzerland

30 March 2011

By Catherine Saez

Funding mechanisms and farmersÕ rights were among the issues that captured the attention of member countries of the International Treaty on Plant Genetic Resources for Food and Agriculture during the biannual meeting of its Governing Body.

 

The fourth session of the Governing Body of the treaty took place in Bali, Indonesia, from 14-18 March.

 

The United Nations Food and Agriculture OrganizationÕs International Treaty on Plant Genetic Resources for Food and Agriculture, based in Rome, seeks to establish a global system to provide treaty users access to global plant genetic materials, with a system of benefit sharing to remunerate countries from which those materials originate if commercial benefits are accrued. It also means to help alleviate hunger and climate change effects.

 

Among outcomes of the meeting was the adoption of a resolution on farmersÕ rights; completion of the information technology infrastructure of the treaty; and completion of the dispute resolution procedure for standard material transfer agreements (SMTAs). Also, the Governing Body adopted a customised mediation procedure, and approved a resolution on the funding strategy for the treaty, dedicating more than US$10 million to the second round of projects of the benefit-sharing fund.

 

Winds of Discontent Blowing on FarmersÕ Rights

One of the main new developments at the governing body meeting was Òa mounting interest and pressure on farmersÕ rights under the Treaty,Ó Shakeel Bhatti, secretary of the treaty, told Intellectual Property Watch after the meeting. There is an increasing interest of countries and civil society organisations in Article 9 of the treaty, Òwhich recognises the farmersÕ rights, subject to national laws and policies,Ó he said.

 

During the meeting, farmers organisations were vocal in their concerns about farmersÕ rights. La Via Campesina, an international peasantsÕ organisation representing about 200 million farmers, said in a 16 March release, that there was a denial of famersÕ rights in many countries. ÒNothing suggestsÓ that industry will pay for benefit-sharing, they said, adding that most governments were implementing the rights of breeders in Òdenial of farmersÕ rights.Ó

 

FarmersÕ rights include the ability to use, sell and exchange seeds and this ability is not widespread, according to farmers. ÒHere in Indonesia, farmers have been thrown in jail for re-sowing part of their own harvest,Ó they said. IP rights on seeds are preventing the further use, sale and exchange of seeds. ÒThe replacement of local seed for hybrids or GMOs [genetically modified organisms] that farmers cannot replant also infringe upon farmersÕ rights,Ó they said.

 

La Via Campesina also said that they supported Òthe position of the African group that believed that the lack of funding of the treaty or the implementation of farmersÕ rights must be regarded as cases of non-compliance.Ó

 

ÒThe treaty adopted a resolution on farmersÕ rights which requests the secretary to convene regional workshops on farmersÕ rights, compile experiences and best practices received from contracting parties on the implementation of farmersÕ rights, and to seek assistance from appropriate sources in the provision of financial and technical support to national governments for the realisation of farmersÕ rights,Ó Bhatti said.

 

Article 9 of the treaty has three sections. The first section recognises the contribution of farmers and local and indigenous communities to crop diversity and conservation. The second section agrees that the Òresponsibility for realising farmersÕ rights rests with national governments.Ó It adds that Òin accordance with their needs and priorities, each contracting party, should, as appropriate, subject to its national legislation, take measures to protect and promote FarmersÕ Rights.Ó Those rights include the protection of traditional knowledge, the right to equitably participate in benefit sharing, and the right to participate in decision making at national level.

 

The third section of Article 9 says that ÒNothing in this Article shall be interpreted to limit any rights that farmers have to save, use, exchange and sell farm-saved seed/propagating material, subject to national law and as appropriate.Ó

 

In a closing statement on behalf of civil society, La Via Campesina said that the main purpose of the treaty is Òto promote the conservation and sustainable useÓ of plant genetic resources, and that the treaty Òcommits to support farmers as primary beneficiaries of the treaty.Ó They demanded support and protection, and in particular, the realisation of their Òinalienable farmersÕ rights to save, use, exchange and sell our seeds and protect our knowledge.Ó

 

The farmers group warned against Òmonopoly privileges for industrial plant breeders.Ó They also called on the governing body to follow the advice of the UN Special Rapporteur on the Right to Food to shift away from Òinput-intensive conventional farming towards agroecologyÓ (IPW, United Nations, 9 March 2011).

 

The Governing Body adopted a resolution on farmersÕ rights to be published shortly, they said.

 

Other Meeting Outcomes

According to Bhatti, among the results of the Governing Body meeting is the completion of the access and benefit sharing systems of the treaty, and in particular the completion of the information technology infrastructure that will be the operational backbone of the global gene pool, which now includes more than 1.5 million samples of genetic material. The mainframe of the infrastructure is hosted in Geneva at the United Nations Information and Computing Centre. The system will store all reported standard material transfer agreements (SMTAs) and is under high security, he told Intellectual Property Watch.

 

The dispute resolution procedure for SMTAs was also completed, Bhatti said, and in particular on intellectual property aspects and benefit sharing. The Governing Body adopted a customised mediation procedure with arbitration carried out, in the last instance, by the International Chamber of Commerce.

 

The Governing Body also reviewed the mandate of the Ad Hoc Advisory Technical Committee on the SMTA and the Multilateral System. This committee is in charge of addressing a range of legal and technical aspects of the access and benefit sharing operations under the multilateral system, including aspects on intellectual property. For example, the committee would address the interpretation of which material would be considered to be in the system by default, so in the public domain, and under the control of contracting parties.

 

By ratifying the treaty, member countries decide to exercise their sovereign rights over their crop genetic resources through the Multilateral System of Access and Benefit-sharing, Bhatti told Intellectual Property Watch. Under the treaty, the multilateral system includes by default all genetic material listed in Annex I of the treaty and which are in the public domain and under the direct management and control of the contracting parties.

 

ÒAdditionally, contracting parties and natural and legal persons within their jurisdictions may include further agricultural plant genetic material, if they so wish, and multiple countries have already done so, such as, for example, the Nordic Genebank (Denmark, Finland, Iceland, Norway and Sweden) and the Dutch Centre for Genetic Resources (CGN),Ó Bhatti said.

 

Countries Slow To Share Resources

According to some sources, only a minor portion of the parties have notified which collections would be placed in the multilateral system and provided the necessary documentation to facilitate access. The vast majority of the genetic material is coming from previous collections of the Consultative Group on International Agricultural Research (CGIAR), they said.

 

According to Bhatti, countries that have included material so far include Brazil, Canada, Czech Republic, Denmark, Estonia, Finland, Germany, Iceland, Jordan, Lebanon, Madagascar, Malawi, Namibia, the Netherlands, Norway, Portugal, Romania, Spain, Sudan, Switzerland, the United Kingdom, and Zambia. The treaty now has 127 contracting parties, according to a press release. An increasing number of countries are sharing their collections into the treaty system, Bhatti said.

 

Assessing collections, often spread out throughout the territory, can be a long process, a source said. Some countries might want to evaluate how the system is working, including the benefit-sharing mechanism, before they include additional material in the system. Another source said those countries might not have yet established the legal system needed to share their resources, but the Òcynical answer,Ó he said, might be Òthat they want to get material from others but not grant others access to their own.Ó

 

For the moment, Òthe genepool which the multilateral system of the treaty creates is a virtual, legally constructed and physically distributed pool of genetic material,Ó Bhatti said. ÒIt is not located in a single physical genebank, but covers hundreds of collections of genetic resources throughout the word.Ó

 

At present, Òmost of the known and documented material within the genepool is located in the international collections of the CGIAR,Ó he said. ÒThe treaty secretariat is partnering with the Global Crop Diversity Trust, and Biodiversity International to create a global accession-level information system, named ÔGeneSys,Õ which will contain description of material in the multilateral system with funding from the Gates Foundation.Ó

 

Funding: the TreatyÕs Achilles Heel

Financial contributions to the treatyÕs benefit-sharing fund have been a worry since the coming into force of the treaty in June 2004, with for the moment financial contributions only coming from governments and not through the benefit-sharing mechanism. Indonesia announced the first developing country contribution to the benefit sharing fund, with a US$100,000 contribution, and called other countries to follow suit, according to a release.

 

Countries financially contributing to the treaty fund are Australia, Canada, Indonesia, Ireland, Italy, Norway, Spain, and Switzerland. International organisations also have committed resources to the fund, Bhatti told Intellectual Property Watch. The fund is now funding projects in 11 developing countries.

 

The International Seed Federation (ISF), representing the seed industry associations at the international level, which told Intellectual Property Watch it has attended every meeting concerning the treaty during its negotiation and after its adoption, said it welcomed the resolution of the Governing Body in Bali on compliance procedures and Òhoped it would lead to a greater implementation of the treaty by its contracting parties,Ó Anke van den Hurk, the ISF representative at the Governing Body said that Òeven with the use of molecular techniques, breeding a new variety could take an average of 8-12 years.Ó

 

She also said that Òmany new varieties were protected using plant breeders rights which allowed them to be used by others without restriction for further research and breeding.Ó This is an important form of benefit sharing recognised by the treaty, she said.

Nonetheless, the industry is Òlooking at innovative approaches to implement the treaty, including the most effective involvement in enhancing the benefit sharing fund projects,Ó she said.

 

La Via Campesina said in its closing remarks that Òthe financial mechanisms and funding strategies under the treaty must not be attached to patents and plant breedersÕ rights,Ó and said the benefit-sharing mechanism had loopholes exempting industrial plant breeders from paying, while only delivering varieties protectedÓ by IP rights.

 

Related Articles:

 

http://www.seedquest.com/news.php?type=news&id_article=15769&id_region=&id_category=&id_crop=

 

Source: Intellectual Property Watch via SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++++

 

1.18  Plant breeders say they have got a new weapon in the war against the illegal use of seeds.

 

The New Zealand Plant Breeding and Research Association says the new DNA technology can clearly identify seed lines and determine their true ownership.

 

Chairperson John Caradus says plant breeders are losing millions of dollars a year from having their seeds ripped off and unlawfully sold.

 

Mr Cardus says growers who illegally produce proprietary seeds should not be allowed to cheat plant breeders by not paying them royalties.

 

The DNA technology is available to use now and seed owners will begin testing on a wide range of rye grasses currently on the market, he says.

 

Copyright © 2011, Radio New Zealand

 

http://www.radionz.co.nz/news/rural/71743/dna-latest-weapon-against-illegal-use-of-seeds

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.19  Two Cents: The GMO Debate

 

March 2, 2011

By Sun Staff

The Sun recently published a series of opinion pieces debating the pros and cons of genetically modified organisms. In the interest of fostering further dialogue on the issue, The Sun solicited the opinions of several knowledgeable professors on the topic.The Sun recently published a series of opinion pieces debating the pros and cons of genetically modified organisms. In the interest of fostering further dialogue on the issue, The Sun solicited the opinions of several knowledgeable professors on the topic — in what will be the first in a series of debates on a host of controversial matters. The aim is to present a sampling of views, which in no way will be entirely comprehensive, but will hopefully allow readers to learn about different topics from a variety of perspectives and disciplines.

 

What are genetically modified foods?

ÒMuch of the form and function of a plant is encoded by the DNA in its cells. When you eat either a genetically modified plant or an organic one, you are also eating its DNA. Knowing the code of a specific gene in a plant, or the code of a plant's entire genome, allows us to observe and understand this source of variation in plant form and function. Two common types of DNA variations are often detected. First, differences in the code for a gene arise due to mutations in the DNA   resulting in alleles or different forms of a gene. The second is diversity in which alleles are strung together to comprise the plant's genome and brought together by pollination of the parent(s). Transgenic or genetically modified plants (G.M.O.s) contain a specifically targeted change in a gene or an insertion of an entirely new gene into a genome.Ó

–– Prof. Mazourek, plant breeding and genetics

 

Lack of FDA Regulation

When on sabbatical in Washington, D.C. in 2002, Prof. David Pelletier, nutritional sciences, explored the scientific and legal basis for the U.S. Food and Drug AdministrationÕs regulations on genetically engineered food. Two categories exist for food regulation: food additive and food adulteration.

As described by Pelletier, the food additive category is more preventive in orientation and requires publicly available testing, documentation and approval before a food goes to market, while the food adulteration clause allows the FDA to respond to unexpected events that happen at some point before and after a food goes to market. From a strictly legal perspective, the FDA chose to give genetically engineered foods (as a class) the presumption of being Generally Regarded as Safe (GRAS), and thereby subject only to the adulteration clause.The dilemma is, G.E. foods do meet the legal definition of a food that needs to be regulated under the food additive clause, but in 1992 (and to this day) we do not have adequate tests for producers to assess the safety of the varied unintended compositional changes that can occur in G.E. foods.

 

ÒThe pro-G.E. scientists typically give the example, Ôpicture a string of yellow beads representing a strand of DNA in the cells of a food and having one bead replaced with a red one. This bead will produce the intended new protein. It only changes one thing in the food.Õ However, we now know that the insertion of one gene can disrupts the functioning of dozens or even hundreds of other genes throughout the genome. ItÕs not beads on a string, but more like a spider web, if you pull on one part, it affects other parts.Ó

 

ÒNone of this means G.E. foods are not safe –– it means we donÕt have good methods for testing them. It also needs to be recognized that the FDA does not require foods from other technologies to undergo such testing.Ó Interestingly, PelletierÕs research documented that from 1994-2004, 21,936 USDA research projects were funded in all areas of food research, but only 19 of these had the keywords of Òplants, biotechnology and allergens,Ó and most of these were devoted to detecting or reducing the risks from known allergens.

 

To date, no such research initiative has been launched. Another problem is that there is no requirement that G.E. foods be labeled, so it is not possible to do epidemiological studies to see if there are any adverse consequences of consuming G.E. foods. Most disturbing to Pelletier is the way in which the policy was developed. He said the FDA did not request input on its draft policy statement from an expert committee of the National Academy of Sciences, nor did it consult any of its advisory committees. ÒMy beef isnÕt with genetically engineered food; itÕs with the process FDA used to formulate its policy, which was an inside job from beginning to end and even disregarded the concerns of senior FDA scientists.Ó

–– Interview with Prof. David Pelletier, nutritional sciences

 

G.M.O.s and Feeding the World

ÒThe worldÕs population is currently about 7 billion and it expected to grow to 9 billion by 2050.  Today, according to the Food and Agriculture Organization of the United Nations, there are more than 900 million undernourished people in the world. The FAO defines undernourished as lacking sufficient calories to meet energy requirements.  In addition, more than 2 billion people, mostly children and women, are iron deficient and an estimated 6,000 children die every day from vitamin A malnutrition.  

 

One strategy for addressing the problem of micronutrient malnutrition (vitamin and mineral deficiency) is biofortification of staple food crops such as rice, wheat, maize, sweet potatoes and beans.  Biofortification is the use of biotechnology to enhance the content and/or bioavailability of vitamins and minerals in foods.  One well-known and promising example of a biofortifed food is golden rice.  Golden rice was developed using genetic engineering to program rice plants to produce beta-carotene in the rice kernels. (Beta-carotene is converted to vitamin A in the body.) This means that conventional plant breeding cannot be used to increase beta carotene in rice kernels, leaving genetic engineering as the only alternative for breeding biofortified rice.   Rice provides as much as 80 percent of the calories in the diets of the poor in many areas of the world and vitamin A deficiency is often prevalent in rice eating areas. 

 

I donÕt believe that genetic engineering alone can save the world from hunger and malnutrition but I do think it is one of many strategies and technologies that we must pursue if we are to have any hope of feeding the 9 billion people who will inhabit out planet by 2050.  All technologies we develop carry risks but I believe we must be willing to take some risks because the alternative is the status quo with millions of people suffering terribly from hunger and malnutrition.Ó 

–– Prof. Dennis Miller, food science

 

Public Perception of G.M.O.s Abroad

Prof. Ronald Herring, government, has done extensive research on genetically modified organisms and their use and impacts in India.   In 2008, Herring wrote an op-ed for The Hindu regarding the misconceptions of the effects of G.M.O.s on Indian farmers. Herring writes, ÒThere is a great puzzle here. If disastrous in 40 countries, why does the technology spread so rapidly across nations and farms? Recombinant DNA technologies represent perhaps the most rapid adoption of any agricultural technology in history. Are farmers irrational, ignorant, duped? The subaltern famously cannot speak, but can she not count either?Ó

 

Herring continued, ÒThere is then no puzzle of farmers adopting disastrous technologies: the disasters exist entirely in the imaginary of advocacy networks that have interests in disasters. The acceptance of molecular breeding technologies is rooted in precisely the agency and rationality of Indian farmers denied in global narratives of G.M.O. opponents. Neither duped nor innumerate, cotton farmers face extreme challenges — from climate change to globally rigged markets — but they do know what works in their fields.Ó

 

Prof. Herring teaches CSS 4100: The G.M.O. Debate: Science and Society, along with Profs. Peter Hobbs and Janice Thies, crop and soil sciences. Though the science behind genetically modified foods is not Herring's academic focus, he shared his thoughts on the subject. When asked about the safety of G.MO.s, Herring responded, ÒThere are studies that show that the transcriptomic errors introduced by other means of plant breeding considered ÔconventionalÕ are greater than those made by recombinant DNA breeding. The question is whether there is more or less risk in genetically engineered plants as opposed to breeding techniques we think of as conventional, that have been normalized. Most important is mutagenic plants, which are bred by taking a traditional cultivar and inducing mutations by radiation or chemical agents called mutagens.  HereÕs the critical point: only recombinant DNA plants –– where genes are spliced together –– are considered ÔG.M.O.sÕ and subjected to special scrutiny."

–– Interview with Prof. Ronald Herring, government

 

Pesticides, Organics, and Comparative Breeding

Prof. Elizabeth Earle, plant breeding and genetics, challenged the assertion of the Feb. 15 opinion piece ÒRejecting Genetically Modified FoodÓ that G.M.O. crops can cause resistance to pesticides.

 

ÒOther genetically modified foods are made to resist insect attack, like BT crops, reducing the use of pesticides. Therefore, they cause the introduction of fewer toxic chemicals in the environment. Consumers ought to be pleased about that.Ó

 

ÒOne of the big arguments about G.M. crops is the problem it creates for organic growers. Organ­ic growers decided themselves that being organic would mean having only a small percentage of their crops as G.M. There are G.M. crops that could be considered favorable for the environment.Ó

 

Finally, food safety remains a contentious aspect of using G.M. plants. ÒPeople have been eating G.M. foods in this country since 1996,Ó Earle said. ÒEverything I've seen on food safety points to the safety of G.M. plants.Ó

 

Earle cited a survey recently published in Plant Physiology that examined 44 microarray studies comparing genetically engineered (G.E.) crops to non-G.E. crops.

 

The authors concluded that there are fewer changes in the plant genome –– in the overall expression of genes and proteins –– of G.E. crops compared to changes caused by traditional breeding or environmental conditions, like drought. ÒThis indicates that the overall changes to the plant genome by G.M. are smaller than the natural variation caused by traditional breeding.Ó

––Interview with Prof. Elizabeth Earle plant breeding and genetics

 

http://www.cornellsun.com/section/science/content/2011/03/02/two-cents-gmo-debate

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++

 

1.20  Mexico oks pilot field of genetically modified corn

 

By Mica Rosenberg

MEXICO CITY, March 8 | Tue Mar 8, 2011 7:15pm EST

MEXICO CITY, March 8 (Reuters) - Mexico on Tuesday approved the first pilot program to plant genetically modified corn, a sensitive topic in the country that touts itself as the birthplace of corn and where small farmers worry the high-tech grain may contaminate native varieties.

 

The Agriculture Ministry granted a permit to global biotech seed maker Monsanto (MON.N) to plant no more than 2.47 acres (1 hectare) with genetically modified corn in the northern state of Tamaulipas.

 

Large commercial farmers in the north say GM corn will help them compete with imports from the United States where the bulk of corn is genetically engineered. GM corn can be higher yielding and more disease resistant.

 

But small, subsistence farmers in southern Mexico worry the biotech crops will threaten native varieties like red, blue and multicolored corn.

 

Corn, first planted in Mexico as many as 9,000 years ago, was worshiped as a deity and later spread by Spanish conquerors to the rest of the world.

 

Mexico imported some 7.2 million tonnes of U.S. yellow corn last year for animal feed and produces mostly white corn to make corn tortillas, the country's staple food.

 

"It is necessary to advance the use of biotechnology to reduce imports and promote national production," the ministry statement said.

 

A pilot program is allowed after an experimental phase of planting in a smaller field has been approved as safe by government inspectors, the ministry said in a statement.

 

Three petitions to expand experimental GM planting in the state of Sinaloa into larger pilot projects were rejected after failing to fulfill regulatory requirements, the ministry said.

 

The government says it has received 121 requests for permits since it began allowing GM corn experiments in 2009.

 

Currently there are around 170 acres (70 hectares) planted with GM corn in small experimental fields the northern corn growing states of Sinaloa, Sonora, Chihuahua, Tamaulipas, Coahuila and Durango, the ministry said.

 

Agriculture officials insist the experimental planting is taking place only in areas where native corn is not common. (Additional reporting by Adriana Barrera; Editing by David Gregorio)

 

http://www.reuters.com/article/2011/03/09/mexico-crops-idUSN0820236920110309

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.21  Details of EU proposals on GM crops

 

March 14, 2011

(Reuters) - EU environment ministers held talks on Monday on proposals to let member states decide individually whether or not to ban the cultivation of genetically modified (GM) crops, in a bid to unblock a paralysis in EU GM approvals.

 

The proposals include an amendment to EU rules on GM cultivation that would allow governments to ban cultivation of approved GM crops on social or economic grounds, such as public opposition or to safeguard organic farming.

 

Below are extracts from the proposals, which must now be approved by a majority of EU governments and lawmakers in order to become law:

 

PROPOSED LEGAL CHANGE TO EU RULES ON GM CROP CULTIVATION

* "The current EU legal framework fully harmonizes cultivation of GMOs. Experience however has shown that cultivation of GMOs is an issue which is more thoroughly addressed by Member States."

 

* "The proposal amends Directive 2001/18/EC by introducing a new article which allows member states to restrict or prohibit the cultivation of authorized GMOs in part or all of their territories."

 

* "The freedom which member states will obtain will only concern the act of GMO cultivation, but not the placing on the market and import of authorized GM seeds which must continue unimpeded."

 

* "The proposal stipulates that member states cannot invoke protection of health and environment to justify a national ban of cultivation of GMOs."

 

* "The measures taken by the member states have to be in conformity with the Treaty on the European Union ... in particular as regards the principle of non-discrimination between national and non-national products and the provisions on quantitative restrictions of trade between member states."

 

* "They should finally be consistent with the international obligations of the EU, and in particular with the one established under the World Trade Organization."

(Compiled by the Brussels newsroom)

 

http://www.reuters.com/article/2011/03/14/us-holdeu-gmo-details-idUSTRE72D66520110314

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.22  Long week ahead for WIPO experts considering treaty on IP and genetic resources

 

Geneva, Switzerland

February 28, 2011

By Catherine Saez, Intellectual Property Watch

Having successfully advanced discussions toward treaties on the protection of folklore and traditional knowledge, country experts this week are meeting at the World Intellectual Property Organization to discuss the protection of genetic resources. But this time, it might prove trickier.

 

The positive results of the two previous working groups have established momentum toward producing the basis for an international treaty text. However, experts this week might face a tougher task with multiple working documents from which to work and the objectives might have to be humbler.

 

The Third Intersessional Working Group (IWG 3) of the WIPO Intergovernmental Committee on Intellectual Property and Genetic Resources, Traditional Knowledge and Folklore (IGC), gathering country experts, is meeting from 28 February – 4 March. The aim is to try to produce a text that would be a basis for negotiations at the 18th session of the IGC from 9-13 May.

The IGC was established by the WIPO General Assembly in October 2000 with the objective of Òreaching agreement on a text of an international legal instrument (or instruments) which will ensure the effective protectionÓ of traditional knowledge, traditional cultural expressions and genetic resources, according to WIPO.

 

In order to help the process, the IGC established three expert working groups to meet between IGC sessions to address the three issues separately. The groups were tasked with providing expert advice and discussions on each subject and provide draft text as a basis for negotiations at the May IGC.

 

The First Intersessional Working Group (IWG 1) of the IGC worked on traditional cultural expressions in July and produced a text that will be presented to the next IGC (IPW, WIPO, 26 July 2010). The Second Intersessional Working Group (IWG 2) addressed traditional knowledge from 21-25 February and also produced a set of draft articles to be brought forward to the ICG (IPW, WIPO, 25 February 2011).

 

Key Issues this Week

A key issue of this weekÕs discussions is the mandatory disclosure of genetic resources in patent applications, according to sources. Another key point is the inclusion of derivatives in the discussions they said. Derivatives are referring to plant extracts, or metabolites (active compounds in plants or animals).

 

Both of those issues were keenly discussed in October during the negotiations leading to the Nagoya Protocol on Access to Genetic Resources and the Fair and Equitable Sharing of Benefits Arising from their Utilization to the Convention on Biological Diversity [pdf].

 

The experts meeting this week have a heavy load of working documents compiled by WIPO to go through, including proposals kept on the table by countries at the 17th IGC meeting in December (IPW, WIPO, 11 December 2010), such as the draft objectives and principles [pdf] proposed by Australia, Canada, New Zealand, Norway and the United States, a submission [pdf] by the African Group on genetic resources and future work, a proposal [pdf] by Switzerland on the declaration of the source of genetic resources and traditional knowledge in patent applications, and a document [pdf] submitted by the European Union also on the source of genetic resources and associated traditional knowledge in patent applications.

 

JosŽ L—pez de Le—n, second secretary of the Geneva Mexican permanent mission, was elected chair of IWG 3, and laid out its roadmap this morning. Today and tomorrow should be devoted to discussing objectives and principles with the aim of shortening the deadline if possible, he told Intellectual Property Watch.

 

The following days will be devoted to developing a matrix of different options, see where they fit with the objectives and principles discussed before, and define priorities. It is important to keep in mind that the discussions have to be kept at a technical level, he said.

On the topic of genetic resources, countries can be broadly defined by two extreme positions and the aim of this week is to deliver two options to which countries can relate to so that the IGC can start negotiating on that basis, he added.

 

According to participants, indigenous peoples vigorously opposed the mention in the objectives and principles of the sovereign rights of states over genetic resources, as that goes against the right to self-determination and the sovereign rights of indigenous peoples as stated in different United Nations conventions and covenants, and in particular their rights over their genetic resources. They also said that the human rights dimensions should be taken into account in the efforts to establish an international instrument.

 

Several countries such as Bolivia and Venezuela also said they wished to have national sovereign rights on the scope of patentability, in particular on life forms, according to sources.

 

The Nagoya Protocol, whose aim is to prevent unlawful appropriation of genetic resources, was adopted on 29 October (IPW, Biodiversity/Genetic Resources/Biotech, 29 October 2010). It includes languages on prior informed consent of indigenous and local communities (Article 6). The protocol was characterised by many as a good starting point but containing softening language like Òas appropriateÓ and Òwhere applicable,Ó with much left to interpretation and to national level implementation.

 

A developed country source told Intellectual Property Watch that disclosure of patent applications is an intellectual property issue and as such should remain under WIPO competence. Another developed country source said that the discussions on objectives and principles would be key to further progress.

 

On 25 February, Mexico became the fifth country to sign the Nagoya Protocol, according to a CBD press release [pdf]. The instrument will take effect at the 50th ratification by countries.

 

Side Events this Week

On Tuesday, South Africa will hold a side event to the IWG 3 on ÒThe National Recordal System as multimedia platform for the recording, documentation and dissemination of indigenous knowledge in South Africa.Ó On Thursday, the International Centre For Trade and Sustainable Development and the United Nations Conference on Trade And Development (UNCTAD) will co-organise a panel discussion on The Nagoya Protocol on Access and Benefit Sharing and its impact on other multilateral debates on intellectual property and biodiversity.

 

More news from: Intellectual Property Watch

 

Website: http://www.ip-watch.org

 

http://www.seedquest.com/news.php?type=news&id_article=15056&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.23 UN-backed treaty meeting seeks to boost conservation of worldÕs plant varieties

 

The Multilateral System forms a gene pool of over 1.3 million unique crop samples

 

14 March 2011 – The governing body of a United Nations-backed treaty considered vital for the preservation and use of the worldÕs threatened plant genetic resources met in Bali, Indonesia, today to map out a future course in the face of food insecurity and climate change.

 

The International Treaty on Plant Genetic Resources for Food and Agriculture, adopted at the Conference of the UN Food and Agriculture Organization (FAO) in 2001 and backed by 127 members, creates a multilateral system through which member countries share the genetic material of 64 of the most important crops for food security – crops that account for more than 80 per cent of our plant-sourced food.

 

No country is self-sufficient in plant genetic resources, and international cooperation and exchange of genetic resources are thus pivotal for food security. Through the Treaty, countries have agreed to establish a multilateral system to facilitate access to key plant genetic resources for food and agriculture, and to share the benefits derived from that access in a fair and equitable way.

 

ÒThe more efficiently crops are protected under the Treaty, the better humankind will be able to conserve and share crop genetic resources to meet the enormous food security challenges of the present and future generations,Ó Treaty Secretary Shakeel Bhatti said.

 

The five-day meeting will consider the full spectrum of plant genetic diversity and the role it can play in providing or cross-breeding varieties that can meet ever changing environmental conditions to provide food for the worldÕs surging multi-billion population.

 

Today, the multilateral system forms a gene pool of over 1.3 million unique crop samples. The Treaty also has a benefit sharing fund by which farmers are supported in the conservation and use of genetic diversity on their own farms.

 

FAO estimates that 75 per cent of crop diversity was lost between 1900 and 2000. A recent study predicted that as much as 22 per cent of the wild relatives of important food crops such as peanut, potato and beans could disappear by 2055 because of a changing climate.

 

The Treaty recognizes the enormous contribution that farmers and their communities have made and continue to make to the conservation and development of plant genetic resources. This is the basis for farmersÕ rights, which include the protection of traditional knowledge, and the right to participate equitably in benefit-sharing and in national decision-making about plant genetic resources. It gives governments the responsibility for implementing these rights.

 

Agriculture ministers and senior officials from more than 100 countries gathered in Bali last week in preparation for this weekÕs meeting and urged those nations who have not yet signed the treaty to do so as soon as possible.

 

They recognized that climate change poses a serious risk to plant genetic resources that are essential as a raw material for crop genetic improvement, whether by farmer selection, classical plant breeding or modern biotechnologies, as well as in adapting to unpredictable environmental changes.

 

Most of the worldÕs food comes from four main crops – rice, wheat, maize and potatoes, but local crops, not among these, are a major food source for hundreds of millions of people and have potential to provide nutrition to countless others. The Treaty helps maximize the use and breeding of all crops and promotes development and maintenance of diverse farming systems.

 

http://www.un.org/apps/news/story.asp?NewsID=37759&Cr=&Cr1=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.24  Rebuild small seed enterprises - Farmers' seed ventures key to food security in developing countries

 

Rome, Italy

1 March 2011

Small seed enterprises are the best way of ensuring the availability and quality of non-hybrid seeds for food and feed crops in developing countries, said FAO in a policy guide published today.

 

According to the World Bank, up to 50 percent of crop yield increases have come from improved seeds, while farmers' access to quality seeds is a key factor for better food and nutrition in poor countries.

 

In recent years, however, a large number governments in the developing world reduced public investment in the seed sector, the expectation being that the private sector would fill the gap.

In many places, especially Africa, this has not happened as medium and large seed companies tend to concentrate on producing hybrid seed for high value crops grown by larger farmers and market them in more fertile, wealthier areas.

 

Sharing not enough

As a result, only about 30 percent of smallholder farmers in developing countries use seed of improved varieties of variable quality — in Africa the percentage is smaller still.

Hybrid seeds provide better yields and disease resistance but cannot be saved by farmers for the next planting, as the hybrid plant seeds do not reliably produce true copies.

 

The majority of poor smallholder farmers growing food security crops such as sorghum, millet and cassava rely on self or open-pollinated seeds or crops that are propagated through dividing bulbs, or taking cuttings stored from previous harvests and grafting them.

 

However, they do not always have access to new varieties that can help them increase production using the same amount of inputs.

 

"It doesnÕt costs a lot comparatively to set up a seed enterprise, especially when it involves local farmers' organizations, but as case studies in the policy guide from three continents have shown, such enterprises can be highly effective in improving food output," said Shivaji Pandey, Director of FAOÕs Plant Production and Protection Division.

 

Brazil, India, Cote DÕIvoire

The policy guide, entitled ÒPromoting the Growth and Development of Smallholder Seed Enterprises for Food Security CropsÓ, is based on case studies from Brazil, India and C™te d'Ivoire, the results of which have been published separately by FAO.

 

In all three cases, a favorable policy environment was found to be a key requirement to the successful development of smallholder seed enterprises.

 

Examples include an efficient quality control and certification system, private sector support, flexible legislation and the legal recognition of the rights of farmers to save, exchange and sell seeds of commercial varieties.

 

Private sector support

Support for privatization and commercialization of agricultural services and the support of plant breeder rights are also imperative. Other factors that can help farmers set up small-scale seed enterprises include reduced tariffs for the import of seed-cleaning and other equipment, key to establishing a seed industry, as adopted by the government of C™te d'Ivoire.

 

Credit must also be available to seed producers; lack of credit was seen as a major hindrance to seed enterprise development and seed producers should be given assistance to run marketing and communications campaigns including the use of rural radio networks to advertise improved varieties to farmers.

 

Marketing help

"Sometimes the seed is there but farmersÕ organizations need assistance and guidance in marketing it to other farmers," said Pandey. Many small-scale seed enterprises have been developed with the support of donors or NGOs but this can lead to aid dependency if both technical and entrepreneurial capacities are not developed for self-reliance, the FAO document warns.

 

It is hoped that legislation governing seeds for the whole of Africa will eventually be harmonized to make it easier for new varieties to cross borders. This is of particular importance because of climate change which is increasing the need for more resilient varieties.

 

Therefore, new hybrid seed must be purchased for each planting. The seed of self-pollinated crops (wheat and beans, for example) can be saved by farmers for next planting.

 

Generally speaking, seed purchased from qualified and reliable seed producers is better in purity, germination and overall quality regardless of whether is hybrid or non-hybrid seed.

 

http://www.seedquest.com/news.php?type=news&id_article=15071&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.25  Genebanks could be storing the wrong seeds - Dutch study investigates the authenticity of heirloom cultivars stored at genebanks

 

Madison, Wisconsin, USA

March 8, 2011

Loss of diversity in crops has prompted many in the global agricultural community to store seeds in genebanks. The seeds can then be used for breeding new cultivars, research, or for crop variance. Crop breeds that have all but disappeared from agriculture are stored and available to the general public.

 

However, genebanks are modern institutions that were established after many of the old cultivars were no longer in use. The seeds stored for old cultivars were collected from numerous sources, many with little information concerning the seed. Therefore, genebanks could be storing seeds that do not genuinely represent the original cultivar.

 

Scientists at the NetherlandsÕ Center for Genetic Resources have examined the extent of the problem of non-authenticity of old cultivars in genebank collections. Using a large lettuce collection from a Dutch genebank, researchers sampled and compared DNA from seeds presumed to be identical because they bared the same cultivar name. The results of DNA testing indicated that many supposedly identical seeds did not match and levels of authenticity were lower than originally presumed, especially in older cultivars. In addition, even recently stored cultivars showed a 10% lack of authenticity.

 

Mark van de Wouw, the author of the study, expressed his surprise by saying, ÒFrom my experiences with other genebanks I did suspect there might be a problem with the authenticity of the seeds that was sent out to users, but I did not realize the problem to be this large. Although current procedures in the genebank avoid to a large extent that new mistakes are being made, the level of mislabeling in the past has apparently been high. It is obvious that systematized efforts need to be made to check the authenticity of the heirloom cultivars in genebank collections.Ó

 

The full study is published in the March/April 2011 issue of Crop Science.

The full article is available for no charge for 30 days following the date of this summary. View the abstract at https://www.crops.org/publications/cs/abstracts/51/2/736.

 

http://www.seedquest.com/news.php?type=news&id_article=15252&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.26  Agriculture ministers and senior officials from more than 100 countries commit to review the world crop gene pool

 

Bali meeting sees climate benefits of genetic diversity in edible plants

 

Bali, Indonesia

11 March 2011

Agriculture ministers and senior officials from more than 100 countries have committed to review the global crop gene pool of the International Treaty on Genetic Resources for Food and Agriculture and urged those countries who have not signed the farming biodiversity treaty to do so as soon as possible.

 

The ministers paved the way forward on the eve of a meeting of the Treaty's Governing Body in Bali, Indonesia on March 14-18, adopting a lengthy declaration designed to steer the Treaty's future course to face food insecurity and climate change.

 

The Treaty, which came into force in 2004, creates a multilateral system through which member countries share the genetic material of 64 of the most important crops for food security - crops that account for over 80 percent of our plant-sourced food.

 

127 countries have already signed the Treaty with more signatures in the pipeline.

 

More tomatoes and more benefits?

Whilst wheat, rice and potatoes are included in the Treaty's gene pool, tomatoes were excluded ten years ago during the negotiations that lead to its adoption.

 

"The more efficiently crops are protected under the Treaty, the better humankind will be able to conserve and share crop genetic resources to meet the enormous food security challenges of the present and future generations," said Shakeel Bhatti, Secretary of the Treaty.

 

"Indonesia is a mega-biodiverse country and has always played a lead role in the Treaty and today it did so again showing that agriculture and environment can and must go along together," said Bhatti.

 

Today, the Multilateral System forms a gene pool of over 1.3 million unique crop samples. The Treaty has also has a benefit sharing fund by which farmers are supported in the conservation and use of genetic diversity on their own farms.

 

Climate dangers

Spain, Italy and Norway and Australia are the major donors to the Benefit-sharing Fund (BSF) set up by the Treaty to support poor farmers in developing countries in adapting their traditional crops to the changing environment.

 

In their declaration, ministers and senior officials also recognized that climate change poses a serious risk plant genetic resources that are essential" as a raw material for crop genetic improvement -whether by means of farmer selection, classical plant breeding or modern biotechnologies-" and also "in the development of new market opportunities, and in adapting to unpredictable environmental changes."

 

It is expected that in the course of this meeting countries would announce new investments to extend the number of activities and conservation projects supported worldwide as well as the number of people that benefit from it.

 

http://www.seedquest.com/news.php?type=news&id_article=15319&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.27  Study shows how plants sort and eliminate genes over millennia

 

West Lafayette, Indiana, USA

March 9, 2011

Hybrid plants with multiple genome copies show evidence of preferential treatment of the genes from one ancient parent over the genes of the other parent, even to the point where some of the unfavored genes eventually are deleted.

 

Brian Dilkes, an assistant professor of genetics at Purdue University, worked with a team of scientists at the University of California Davis and University of Southern California to study the genome of Arabidopsis suecica, a hybrid species with four chromosome sets formed tens of thousands of years ago from a cross between Arabidopsis arenosa and Arabidopsis thaliana, a plant commonly used in laboratories for genetic research. Dilkes said the findings, published in the journal Genome Biology and featured as an editor's choice article in the journal Science, give a glimpse into the evolutionary forces and ultimate fates of genes contributed by the two parents to a hybrid

 

"There often is no visible signature of these genes when we look at the plants with a microscope, but we can still observe those genes in the genome sequence," Dilkes said. "Moreover, the ability to make crosses between Arabidopsis thaliana and Arabidopsis arenosa gives us the opportunity to compare laboratory-derived plants that were generated yesterday with naturally occurring species from the wild and compare the two kinds of species hybrids. This is essentially allowing us an opportunity to 'replay the evolutionary tape,' in the words of Stephen J. Gould."

 

The researchers compared the genomes and gene expression among Arabidopsis suecica plants that have evolved over tens of thousands of years to similar species of hybrids made in the lab from fresh crosses.

 

When the contribution of genes from each parent was compared, they were not equal. One parent's genes were preferentially expressed at higher levels. In the cases where that happened, it was three times more likely that the preferentially expressed genes came from Arabidopsis arenosa.

 

The team also found that gene pairs that are co-expressed in similar tissues are preferentially expressed from the same parent. Even in the rare cases when an Arabidopsis thaliana gene was more abundantly expressed in the hybrid, co-expressed genes would also be preferentially expressed from the Arabidopsis thaliana copy.

 

"Our findings suggest an additional network dependence, where genes fine-tuned to work together within either parental species prior to hybridization are more likely to be expressed together in the hybrid. This, in turn, ensures that these genes acquired from one parental species are kept together and are not lost in the genome over time," said Peter Chang, a graduate student at USC and lead author on the paper. "Plants have had a remarkable ability to adapt to different conditions throughout Earth's history, and we are just beginning to understand some of ways this is done."

 

Previous work has shown that plant genomes with historical duplications from tens of millions of years ago have lost one of the two copies in large blocks along the chromosome, consistent with the preferential loss of one parent's contribution.

Dilkes said the retained genes may have a role in the plants' fitness but genes that weren't expressed would be deleted from the genome.

 

"The genome is moving toward a two-copy organization, a diploid, by preferentially deleting one parent. When others have looked at genomes that have ancient duplications they see large blocks of duplications in which one block has a large number of genes and the other has a sparse gene content," Dilkes said. "Perhaps a cause of this pattern in the organization of genomes is preferential expression, and, all other things being equal, the gene that is more abundantly expressed will carry a greater proportion of the fitness load for any essential function."

 

The National Science Foundation funded the research.

 

http://www.seedquest.com/news.php?type=news&id_article=15270&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.28  U.S. dairy farmer finds unusual forage grass

 

Washington, DC, USA

March 15, 2011

Description: http://www.ars.usda.gov/is/graphics/photos/mar11/d2119-1i.jpgA U.S. Department of Agriculture (USDA) grass breeder has rediscovered a forage grass that seems just right for today's intensive rotational grazing.

 

A farmer's report of an unusual forage grass led Michael Casler, an Agricultural Research Service (ARS) geneticist at the agency's U.S. Dairy Forage Research Center in Madison, Wis., to identify the grass as meadow fescue, Schedonorus pratensis. Meadow fescue (photo) has been long forgotten, although it was popular after being introduced about 50 to 60 years before tall fescue.

 

ARS is USDA's principal intramural scientific research agency.

 

Casler has developed a new variety of meadow fescue called Hidden Valley, and its seed is being grown for future release.

 

Non-toxic fungi called endophytes live inside meadow fescue, helping it survive heat, drought and pests. Unlike the toxic endophytes that inhabit many commercial varieties of tall fescue and ryegrass, meadow fescue does not poison livestock.

 

Charles Opitz found the grass growing in the deep shade of a remnant oak savannah on his dairy farm near Mineral Point, Wis. He reported that the cows love it and produce more milk when they eat it. Casler used DNA markers to identify Opitz's find.

 

Meadow fescue is very winter-hardy and persistent, having survived decades of farming. It emerged from oak savannah refuges to dominate many pastures in the Midwest's driftless region, named for its lack of glacial drift, the material left behind by retreating continental glaciers.

 

Casler and his colleagues have since found the plant on more than 300 farms in the driftless region of Wisconsin, Iowa and Minnesota. Geoffrey Brink, an ARS agronomist working with Casler, discovered that meadow fescue is 4 to 7 percent more digestible than other cool-season grasses dominant in the United States.

 

In another study, meadow fescue had a nutritional forage quality advantage over tall fescue and orchardgrass that may compensate for its slightly lower annual yield further north, as reported in the Agronomy Journal. Also, the yield gap begins to close with the frequent harvesting involved in intensive grazing.

 

Read more about the research in the March 2011issue of Agricultural Research magazine.

 

Photo by Michael Casler.

 

http://www.seedquest.com/news.php?type=news&id_article=15391&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++

 

1.29  The cult of heirloomism

 

Farmers and home gardeners embrace old seeds— but are they better?

 

DREW KELLY/New York Times

CRAIG DILGER/New York...

HEIRLOOM_SEEDS_6.jpg

Rob Johnston, founder of Johnny's Selected Seeds, says modern seeds produce a more vigorous plant and have better resistance to disease.

 

As gardeners stock up on heirloom seeds for spring, Rob Johnston, the chairman of JohnnyÕs Selected Seeds in Winslow, Maine, would like to suggest an accessory. Why not buckle up in a 1936 Oldsmobile coupe?

 

OK, so it doesnÕt have seatbelts. But the swoop of the fenders resembles Joan CrawfordÕs eyebrows. Better yet, the rest of the OldsmobileÕs curves are all Lana Turner.

 

And the technology! Where else can todayÕs driver find such innovations as knee-action wheels and a solid steel Òturret topÓ?

 

Even with all a Õ36 Olds has going for it, Johnston said, ÒIÕm not sure how big of a market there would beÓ for 75-year-old cars. ÒIt would just be a sentimental business.Ó

 

So to return to JohnstonÕs own business, vegetable seeds, why is the back yard gardener buying so many 1936-era heirlooms?

 

Johnston, it should be noted, is a fan of heirlooms, which in the broadest sense, are old varieties of open pollinated seeds that will grow the same plant again.

 

He argues that his typical customers — small market farmers and avid home gardeners — have better choices. Modern seeds, generally hybrid crosses, produce a Òmore vigorous plant, better resistance to diseases.Ó

Source: Xinhua via Chinese Academy of Sciences

 

And hereÕs the heirloom heresy: They often taste better, too.

 

Heritage seed buyers could rebut some or all of those claims — and they do. But agronomy, in a sense, is the least of it.

 

Seventeen years ago, in the New York Times, writer Michael Pollan spelled out the economic and environmental hazards of hybrid seeds in an article that came with a fright-movie title, The Seed Conspiracy.

 

In the years since, the superiority of certain types of seed has grown into a kind of orthodoxy among right-thinking gardeners. The philosophy could be called heirloomism. According to some plant breeders and seed sellers, it propagated a reactionary — and sometimes confused — argument about food, farming and science.

 

The debate may seem abstract. But one question it raises for the gardener is plain as dirt: What kind of seeds will succeed?

 

One thing nobody would dispute is that business is booming in heirloom seeds. Seed Savers Exchange in Iowa, a leading source of heirlooms, has seen sales Òincreasing dramatically,Ó said the executive director, John Torgrimson.

 

Sales shot up 100 per cent in 2008 at Baker Creek Heirloom Seeds, a Missouri garden company that stocks 1,200 vegetable varieties, and the last two years have brought 20 per cent annual growth, said the companyÕs owner, Jere Gettle.

 

According to a survey by the National Gardening Association, one in five American households with a yard or garden reports an interest in heirloom fruits, berries and vegetables. But Gettle, 30, contends his generation cares even more about heirlooms.

 

ÒNew gardeners, younger gardeners — 90 per cent are interested in heirlooms and traditional varieties,Ó Gettle said.

 

The appeal is plain to see, not just to taste. The Baker Creek catalogue can deliver as much wonderment as the Westminster Kennel Club Dog Show. How can common vegetables come in so many comical shapes and unlikely colours?

 

Beyond the aesthetics, Gettle said his customers espouse Òalmost a total rejection of GMOs,Ó or genetically modified organisms. Further, they donÕt want Òhybridization in their seed supply. They want to be independent and be able to save their seeds. They donÕt like the big boys.Ó

 

One of the undeniable big boys in garden seeds is W. Atlee Burpee & Co. The Doylestown, Pa., company is AmericaÕs largest purveyor of open-pollinated seeds. Chief executive officer George Ball said heritage seed sales have outpaced the rest of BurpeeÕs seed line so more varieties have been added.

 

But this Òthird-generation seed manÓ also seems to relish acting as a heckler of the heirloom movement. In an op-ed piece in the Des Moines Register last summer, Ball wrote, ÒToday, greener-than-thou gardeners crusade for heirloom seeds while unjustly condemning hybrids. Increasingly, their anti-science credo has hardened into a Luddite fundamentalism.Ó

 

Ball laughs a bit about the bombast of phrases like Ògreener than thou.Ó But he sticks by his main claim.

 

ÒHeirlooms were varieties that were so unsuccessful they wouldnÕt be sold today,Ó he said. ÒEvery product declines until itÕs replaced by new heirlooms.Ó

 

That term, new heirlooms, may seem like an oxymoron. Yet while heirloom seeds stay stubbornly the same, the heirloom brand continues to evolve.

 

One of the first print references to heirlooms appeared in a 1949 article in the New York Times, according to the Oxford English Dictionary. That dictionaryÕs definition of ÒheirloomÓ matches the one used by Seed Savers Exchange: open-pollinated varieties that are more than 50 years old and have been handed down through generations.

 

But that classification describes only a portion of the 13,500 varieties in the groupÕs yearbook. So Torgrimson, 60, embraces a wider and more useful classification that includes four categories.

 

First, there are the family legacies, such as BakeryÕs squash. Emma Adkins, of Van Lear, Ky., took this striped acorn cultivar from her motherÕs garden and donated it to Seed Savers in 1994.

 

Perhaps the greatest number of heirloom seeds come from the second group: old market varieties. A classic example is the Danvers carrot. The Fedco Seeds catalogue traces this vegetable back to Massachusetts farmers in 1871.

 

Third is a Òmodern heirloomÓ such as the sugar snap pea. Vegetable breeder Calvin Lamborn developed this open-pollinated favourite for Gallatin Valley Seed Co. in the 1970s.

 

The origins of the sugar snap, a rogue, thick-walled pea, lie in TorgrimsonÕs fourth category, Òmystery heirlooms.Ó These are serendipitous discoveries and field crosses that farmers and gardeners decide to preserve and plant again.

 

In the plainest sense, heirlooms are just old seeds. What has changed is the way we venerate them, said Bill Tracy, 56, a sweet-corn breeder and professor of agronomy at the University of Wisconsin.

 

Tracy estimates that, over the decades, he has grown 75 to 80 per cent of these varieties.

 

Marketing them as heirlooms, however, is Òa new concept, a concept of the early 21st century,Ó Tracy said. Plants are sexually active, mutable things, he explained. They can be adapted to different climates, soil types and planting and harvest dates.

 

ÒThe farmer or the gardener has the opportunity to select the type that is best for their farm,Ó he said. And Òprevious generations of farmers, our parents or grandparentsÓ did just that.

 

An open-pollinated seed wasnÕt an item to be named, treasured and monastically cloistered. For their part, the seed companies and catalogues, which were then small and regional, collected seeds from the plants that performed best from year to year.

John Navazio, 56, a Washington State University seed specialist and senior scientist for the Organic Seed Alliance, suggests the growers who developed heirloom seeds wouldnÕt be content with them today.

 

ÒA 1902 cabbage by Burpee was a perfectly good cabbage by 1902 standards,Ó Navazio said. ÒBut none of our ancestors ever viewed these things as done. You never stopped breeding your livestock. You never stopped selecting your cabbage.Ó

 

For the discriminating food shopper, the word ÒheirloomÓ has another meaning. Heirloom vegetables are the delicious ones. These are the turnips dolled up in magazine photo spreads and honoured by name on the menus of the better restaurants — even some of the worst ones.

 

Torgrimson admits he has dallied with a few hybrids in the past. But Òyou canÕt beat the tasteÓ of heirlooms, he said. He recalled what a visitor to Seed SaversÕ Heritage Farm asked last summer after biting into a gusher of a tomato: ÒWhy does the tomato in the store taste like a red rubber ball?Ó

 

Bob Heisey, a 62-year-old tomato-and-pepper breeder for United Genetics Seeds Co., has heard that question before.

 

ÒA lot of the complaints,Ó he said, Òare about supermarket tomatoes that are picked when theyÕre green, and gassed with ethylene to develop the red colour and then refrigerated to keep them fresh so that they look marketable when they get to the store.Ó

 

Heirlooms are not intrinsically more appetizing than modern hybrids. Heirlooms began as hybrids, after all — a fortuitous cross of two parents. Modern hybrids, or so-called ÒF-1s,Ó are usually proprietary to a seed company. But this is still the 19th-century genetics of Gregor Mendel, not genetic engineering.

 

Heirlooms grow glorious fruit for many reasons. One is size. An heirloom tomato is often a big, robust plant. The central stalk is usually indeterminate: It keeps shooting up after setting fruit. Ball, of Burpee, recalls a customer telling him about a Brandywine plant that crept into the house through a second-floor window.

 

An heirloom tomato will also have a lot of leaves, in groups of three, Heisey said. All that green surface area translates into a lot of photosynthesis, which means higher sugar levels, one of many factors that make for a mythic tomato.

 

A modern, hybrid tomato, by comparison, is typically determinate in the way it grows: The stem will stop growing. The leaves come in pairs. Farmers prefer compact plants with earlier and higher fruit yields.

 

But thatÕs not the end of the story. As any impatient gardener will testify, many of those old tomato plants donÕt like to be hurried to make fruit. While theyÕre hanging around the yard, the foliage can pick up a legion of common diseases.

 

As the stricken plant sheds leaves, it has less sugar to channel into the fruit.

 

By comparison, some blight resistance has been bred into the hybrid for decades, Heisey said. Most commercial types now have resistance, as do many back-yard varieties.

 

The great bank of heirloom seeds is ripe for fresh creations and practical improvements, said Navazio of the Organic Seed Alliance.

 

ÒWhen people say hybrids are better than the OPs, well, duh! YouÕve been throwing all of your brainpower at developing hybrids for more than 30 years. And the nonhybrids, the OPs, have sat and languished with almost no one doing any good selection and genetic maintenance on them. At that point, itÕs a self-fulfilling prophecy.Ó

 

His organizationÕs cause is not to romanticize old seeds, he said. Instead, the Washington-state nonprofit hopes to rebuild the regional farming culture that invented those cultivars. The place for such a movement to start, Navazio argues, is the small farm. And the people to do it are the farmers themselves.

 

As Siskiyou announces on the front page of its website, ÒOur vision is to connect seed growers, gardeners and farmers in a mutually beneficial relationship to support small-scale agriculture with superior genetics selected for the Pacific Northwest.Ó

 

Put another way, Siskiyou isnÕt dealing in nostalgia. What they pledge to sell is a better seed.

 

http://www.thespec.com/living/style/article/508244--the-cult-of-heirloomism

 

Source: New York Times News Service via SeedQuest.com

 

Return to Contents)

 

++++++++++++++++++++

 

1.30  Genebanks could be storing the wrong seeds

 

Scientists at the Netherlands' Center for Genetic Resources led by Mark van de Wouw, have examined the extent of the problem of non-authenticity of old cultivars in genebank collections. Large lettuce collections from a Dutch genebank were sampled and DNA from seeds which bear the same cultivar name were analyzed. The results of the DNA analysis showed that many supposedly identical seeds did not match and levels of authenticity were as low as 10%, especially in older cultivars.

 

Mark van de Wouw expressed his surprise when he said "From my experiences with other genebanks I did suspect there might be a problem with the authenticity of the seeds that was sent out to users, but I did not realize the problem to be this large. Although current procedures in the genebank avoid to a large extent that new mistakes are being made, the level of mislabeling in the past has apparently been high. It is obvious that systematized efforts need to be made to check the authenticity of the heirloom cultivars in genebank collections."

 

The original news can be seen at https://www.crops.org/news-media/releases/2011/0308/460/

 

Source: Crop Biotech Update 11 March 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++

 

1.31  'Tequila' plants as biofuel crops

 

Agave is well-known for its role in the production of alcoholic drink tequila, however, experts say that it is also a potential biofuel crop, with better characteristics than other crops which are also used for food and feed. According to several studies, agave plants can produce high yields amidst extreme temperatures, droughts, and high levels of carbon dioxide, with less irrigation.

 

Field trials of Mexican agave varieties have started in Australia. According to one paper, two varieties (Agave mapisaga and Agave salmiana) produce high yields under intensive management, and far exceed corn, soybean, sorghum, and wheat yields.

 

"Mexico has 80 million hectares of arid and semi-arid areas with no productive potential in which 5,600 million tons of dry biomass could be obtained from agave," said Arturo Velez, head of the Agave Project in Mexico. This would be enough to meet the United States' transport fuel needs.

 

Read the papers from the Global Change Biology issue on bioenergy at http://onlinelibrary.wiley.com/doi/10.1111/gcbb.2011.3.issue-1/issuetoc

 

Source: Crop Biotech Update 18 March 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++

 

1.32  Scientists study diversity between and within farmersÕ tomato varieites from Eritrea

 

Tomato (Solanum lycopersicum) is one of the economically important crops in Eritrea. However, the average yield of tomato in Eritrea is significantly smaller than the yield of tomato varieties from Africa and Italy. Thus, Samuel Asgedom of the Hamelmalo Agricultural College in Eritrea and colleagues analyzed the genetic diversity of 25 Eritrean tomato varieties commonly grown by farmers and compared them with other African and Italian varieties. Fifteen simple sequence repeat (SSR) molecular markers were used for the genetic analysis.

 

The researchers observed a high degree of diversity among the Eritrean varieties. Thirteen out of the 15 molecular markers express different phenotypes. Two major types of varieties were identified, and these are San-Marzano and Marglob. Eritrean varieties were also found to have less uniform genotypes compared to the Italian and African varieties. Based on a survey among the tomato farmers, some of them intentionally mix seeds of different varieties to extend the harvesting period, for yield stability, and stress tolerance.

 

Read the abstract of this study at http://www.academicjournals.org/AJB/PDF/pdf2011/21Mar/Asgedom%20et%20al.pdf

 

Source: Crop Biotech Update 25 March 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++++

 

1.33  Flood-tolerant rice plants can also survive drought, say UC Riverside scientists

 

Riverside, California, USA

March 2, 2011

Rice, which is sensitive to drought due to its high water requirement, is particularly vulnerable to how global climate change is altering the frequency and magnitude of floods and droughts. If rice plantsÕ combined tolerance to flooding and drought could be improved, however, rice productivity could be protected and even substantially increased.

 

Now plant scientists at the University of California, Riverside have made a discovery that can greatly benefit rice growers and consumers everywhere. The researchers have demonstrated in the lab and greenhouse that rice that is flood tolerant is also better able to recover from a drought.

Description: http://www.seedquest.com/visuals/image/2011/riverside.jpg

The images show rice plants treated with drought, followed by recovery. Each image shows two kinds of rice plants. The plants to the left of the red tape lack the Sub1A gene; the plants to the right of the red tape have Sub1A. The image marked "Day 0" shows the plants when the experiment began. The image marked "Day 8" shows the plants on the eighth day of drought. The image marked "Recovery" shows that only the plants with the Sub1A gene are recovering from drought stress after the pot was regularly watered for 14 days after Day 8. Photo credit: Bailey-Serres lab, UC Riverside.

 

 

ÒFlood tolerance does not reduce drought tolerance in these rice plants, and appears to even benefit them when they encounter drought,Ó said Julia Bailey-Serres, a professor of genetics in the Department of Botany and Plant Sciences, who led the research project.

 

Bailey-Serres and her team – Takeshi Fukao, a senior researcher, and Elaine Yeung, an undergraduate student – focused on Sub1A, a gene responsible for flood or ÒsubmergenceÓ tolerance in rice and found only in some low-yielding rice varieties in India and Sri Lanka. Sub1A works by making the plant dormant during submergence, allowing it to conserve energy until the floodwaters recede. Rice with the Sub1A gene can survive more than two weeks of complete submergence.

 

Plant breeders have already benefited farmers worldwide – especially in South Asia – by having transferred Sub1A into high-yielding rice varieties without compromising these varietiesÕ desirable traits—such as high yield, good grain quality, and pest and disease resistance.

 

Bailey-SerresÕs lab found that in addition to providing robust submergence tolerance, Sub1A aids survival of drought. The researchers report that at the molecular level Sub1A serves as a convergence point between submergence and drought response pathways, allowing rice plants to survive and re-grow after both extremes of precipitation.

 

Study results appear in the January issue of The Plant Cell. The journal has the highest impact factor of primary research journals in plant biology. The research paper also has been selected as a recommended read in the Faculty of 1000.

 

Bailey-SerresÕs lab investigated the drought tolerance of flood-tolerant rice plants because her research team wanted to be sure that the flood tolerance trait, which the lab has studied for many years, did not reduce the ability of the plant to endure some of the other common stresses – such as drought.

 

ÒWe found that Sub1A properly coordinates physiological and molecular responses to cellular water deficit when this deficit occurs independently, as in a time of drought, or following Ôdesubmergence,Õ which takes place when flood waters recede,Ó Bailey-Serres said.

 

She explained that after a flood, a period follows when the leaves that have been submerged lose water and become dehydrated. Moreover, because a period of dehydration is part of the natural progression of a flood, Sub1A also happens to have benefits after desubmergence and is therefore important for drought tolerance as well.

 

ÒOur finding suggests that the plant recovers well from drought by growing new shoots,Ó Bailey-Serres said. ÒThis is something that is also seen with flooding.Ó

 

Next, colleagues of Bailey-Serres at the International Rice Research Institute in the Philippines will test the Sub1A rice for drought tolerance in the field.

 

The research was supported by a grant from the U.S. Department of Agriculture (USDA) Cooperative State Research, Education, and Extension Service to Bailey-Serres, who is the lead recipient of the 2008 USDA National Research Initiative Discovery Award. Fukao is the first author of the research paper.

 

http://www.seedquest.com/news.php?type=news&id_article=15117&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++

 

1.34 Improving rice yield in salty soils

 

Malaysia

March 3, 2011

Researchers have measured the genetic diversity of saline tolerant rice from across India. This analysis is used to predict which genotypes should be used to develop higher yields in difficult, salt rich soil conditions, and the work is published in Pertanika Journal of Tropical Agricultural Science (JTAS) this month.

 

The presence of excess salt is one of the most widespread soil toxicity problems in many rice growing areas. In particular, it accounts for 8.5 million hectares of land in India and the yield reduction is estimated at 30-50%.

 

The success of any breeding programme is dependent on the available genetic divergence in the crop. Dr. A. Anandan and colleagues measured genetic diversity in forty-four salt tolerant rice types from different geographical regions. They analysed the genetic relationships among extant genotypes in order to provide information about genetic diversity. They divided the seeds into 12 clusters. The results suggest that geographical distribution is not necessarily related to genetic divergence, with several diverse regions appearing in the same clusters. They also found that genotypes from the same geographic region appeared in different clusters, and may be due to genetic heterogeneity – i.e. different genes producing identical phenotypes.

 

They identify promising genotypes for future use in breeding to develop saline tolerant genotypes and estimate the relationship between measurable traits associated with yield under a saline environment.

 

Facts about rice are available from the International Rice Research Institute website: http://irri.org/about-rice/rice-facts

 

Pertanika Journal of Tropical Agricultural Science (JTAS) is published by Universiti Putra Malaysia in English and is open to authors around the world regardless of nationality. It is currently published twice a year in February and August. Other Pertanika series include Pertanika Journal of Science & Technology (JST), and Pertanika Journal of Social Sciences & Humanities (JSSH).

 

http://www.seedquest.com/news.php?type=news&id_article=15138&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.35 Molecular marker screening of tomato germplasm for root-knot nematodes resistance

 

March 4, 2011

Tomato (Solanum lycopersicum L.), an economically important vegetable, has been frequently savaged by root-knot nematodes causing production losses in Ghana. The use of effective nematicides have been banned due to their environmental and health risks. Previous studies have shown that the gene Mi found in tomatoes confers genetic resistance to root-knot nematodes. Thus, Y. Danso of Crops Research Institute (CSIR), Kumasi, Ghana and other scientists, conducted molecular screening on some tomato germplasm to detect markers of Mi.

Based on the results, the tomato cultivars VFNT, FLA 505-BL 1172, 2641A, "Adwoa Deede" and Terminator FI showed the marker for the homozygous resistant genotypes (Mi/Mi). The cultivars, Tima and 2644A showed both markers, corresponding to heterozygous resistant genotypes (Mi/mi). Twenty one (21) out of the 26 cultivars did not show any of the markers probably because of non-specificity at the primer-binding sites. Five (5) heterozygous individuals of the 6 resistant cultivars were found to be following the Hardy-Weinberg equlibrium in population genetics.

Read the abstract of this study at http://www.academicjournals.org/AJB/abstracts/abs2011/28Feb/Danso%20et%20al.htm.

http://www.seedquest.com/news.php?type=news&id_article=15172&id_region=&id_category=&id_crop=

 

Source: Crop Biotech Update via SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++++

 

1.36  United Kingdom - BASF launches new canopy assessment tool app for iPhone

 

United Kindgom

March 10, 2011

A new Canopy Assessment Tool App for iPhone has just been launched by BASF in the UK for the 2011 season.

 

The CAT App for iPhone allows the user to take a photo of their wheat crop at growth stage 30-31 and the green area index (GAI) of that crop will be immediately reported on the iPhone in the field. Accurately assessing a crop's GAI can be tricky, but its a critical indicator for fertiliser and agrochemical application timings. From this GAI assessment, with information on the variety grown and predicted yield, the CAT will provide a tailored field report on lodging risk, a tailored PGR programme, and crop nitrogen content (in kg/ha) measured for fertiliser calculations.

 

The BASF CAT is a revolutionary tool to help farmers and advisors protect their yield by assessing crop lodging risk. It is an easy to use practical aid, allowing appropriate PGR programmes to be devised and calculating crop nitrogen requirements accurately. It helps to justify inputs and is very much a part of an on-going ICM approach.

 

The CAT App for iPhone replicates the on-line tool hosted at www.pgrplus.basf.com launched in 2010.

 

The BASF CAT App for iPhone can be downloaded from iTunes.

 

The main benefits of the CAT App for iPhone over the on-line tool are:

 

http://www.seedquest.com/news.php?type=news&id_article=15324&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.37  Research finds path to corn smut resistance

 

St. Louis, Missouri, USA

March 18, 2011

The National Corn Growers Association funded research recently released by The Danforth Plant Science Center that may lead to a variety of corn that is highly resistant to corn smut caused by the fungus Ustilago maydis. With no genetic resistance to this fungal infection, smut fungi are agents of disease responsible for significant crop losses worldwide; this research gives a path to find a resistance to the infection.

 

The results of this research, which was conducted by principal investigator Dr. Thomas Smith and research associate Dr. Dilip Shah, are published in the Plant Biotechnology Journal.

 

Corn is the most economically important crop in the United States, and American corn farmers planted nearly 90 million acres, generating nearly $50 billion in 2010. In addition to food and feed, the current emphasis on biofuels has elevated the importance of corn in U.S. agriculture in recent years.

 

Corn smut is an airborne fungus found most frequently on ears, tassels and nodes. Sweet corn is more susceptible to corn smut than is seed corn, with annual losses often as high as 20 percent in the United States, where corn smut is responsible for approximately $1 billion in crop losses annually overall.

 

Prior to the Danforth Center discovery, there were no corn varieties that were naturally immune to Ustilago maydis. Several methods to control the disease have been recommended including, crop rotation, sanitation, seed treatments, application of fungicides and modification of fertility and biological controls. Drs. Smith and Shah explored an alternative approach using a naturally found killer protein, KP4, made by a virus that lives in one specific strain of corn smut.

 

Toxicity studies have shown that the KP4 proteins are safe for humans and animals to consume. Smith and Shah will continue to explore KP4 and other antifungal proteins ability to control other pathogenic fungi.

 

"Applying our control method could significantly reduce annual losses caused by corn smut and other fungi," said Smith. ÒPlants often require a number of genes to only partially protect the plant from a particular fungal infection, making it difficult to use traditional breeding methods to develop resistant lines. Here we have shown that a single gene that can lend extremely robust protection, giving us hope that there are other similar and effective solutions to be found in nature."

 

http://www.seedquest.com/news.php?type=news&id_article=15528&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.38  Nuevos resultados genŽticos sobre la calidad del trigo

 

Investigadores de la Universidad PolitŽcnica de Madrid identifican nuevos genes implicados en la calidad panadera del trigo

 

Madrid, Spain

March 21, 2011

Las prote’nas del gluten son las principales responsables de la calidad del trigo panadero. Sin embargo, no son las œnicas. Investigadores de la ETSI Agr—nomos de la Universidad PolitŽcnica de Madrid, tras dos a–os de ensayos, han localizado regiones cromos—micas del trigo fuertemente correlacionadas con par‡metros de calidad, cuyo estudio servir‡ para identificar nuevos genes relacionados con ella.

 

El trigo panadero (Triticum aestivum ssp vulgare L.) es, junto con la cebada, el cultivo nacional m‡s importante en tŽrminos de producci—n y de superficie cultivada. Los productos derivados de este cereal, tanto el pan como las galletas, boller’a y pasteler’a son alimentos que forman parte fundamental de la dieta en todos los hogares. Durante los œltimos a–os se ha producido una gran proliferaci—n de nuevos productos de este gŽnero, fruto de los trabajos realizados sobre la calidad harinera del trigo blando, indispensables para poder satisfacer tanto las exigencias de la industria como las preferencias de los consumidores.

 

La genŽtica de la calidad del trigo es objeto de estudio desde hace muchos a–os de numerosos grupos de investigaci—n nacionales e internacionales, entre los que se encuentra el Grupo de Investigaci—n de Mejora GenŽtica de Plantas de la UPM, experto y referencia nacional en este tema.

 

En el caso del trigo panadero, aunque las prote’nas del gluten son los principales determinantes de la calidad, existen evidencias que apuntan a que debe haber otros componentes de la harina implicados, aœn por caracterizar, cuyo conocimiento ser’a de gran utilidad en los programas de mejora.

 

Con el objetivo de profundizar en este aspecto, los investigadores de la UPM generaron una colecci—n de l’neas recombinantes de trigo derivadas del cruzamiento entre dos variedades comerciales (ÒMariusÓ y ÒCajemeÓ) con distinta calidad. Se llevaron a cabo ensayos de campo durante dos a–os, y se aplicaron las tŽcnicas est‡ndar en la industria panadera para la evaluaci—n de las propiedades funcionales de la harina, como son el an‡lisis del mix—grafo, el alve—grafo o el test del volumen de sedimentaci—n. La realizaci—n de un mapa genŽtico con 300 marcadores de ADN de tipo SSR (microsatŽlite) permiti— localizar en los cromosomas 2A, 7A y 5B nuevos QTLs (quantitative trait loci), regiones cromos—micas que est‡n fuertemente correlacionadas con los par‡metros de calidad estimados. Estos cromosomas, que actualmente est‡n siendo estudiados en profundidad con un mayor nœmero de marcadores, constituyen el punto de partida fundamental para la identificaci—n de nuevos genes.

 

Los resultados del estudio forman parte de una tesis doctoral y han sido publicados recientemente en Journal of Cereal Science, revista cient’fica especializada(1).

 

(1)Kerfal, S; Giraldo, P; Rodriguez-Quijano, M; Vazquez, JF; Adams, K; Lukow, OM; Roder, MS; Somers, DJ; Carrillo, JM; Mapping quantitative trait loci (QTLs) associated with dough quality in a soft x hard bread wheat progeny. JOURNAL OF CEREAL SCIENCE 52 (1): 46-52 JUL 2010.

 

http://www.seedquest.com/news.php?type=news&id_article=15605&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.39  Key plant traits yield more sugar for biofuels

 

Research by UC Riverside's Charles Wyman could lead to less expensive production of biofuels

 

Riverside, California, USA

March 28, 2011

New clues about plant structure are helping researchers from the Department of EnergyÕs BioEnergy Science Center narrow down a large collection of poplar tree candidates and identify winners for future use in biofuel production.

 

Led by Charles Wyman of the Bourns College of EngineeringÕs Center for Environmental Research and Technology at the University of California, Riverside, a research team from Oak Ridge National Laboratory, the National Renewable Energy Laboratory and UCR determined that the amount and composition of lignin in the plantÕs cell wall interact in an unanticipated way to influence release of sugar from the plant.

 

The research was published as ÒLignin content in natural Populus variants affects sugar release,Ó in the Proceedings of the National Academy of Sciences.

 

Lignin serves as a major roadblock for biofuel production because it forms strong bonds with sugars and interferes with access to these carbohydrates, making it difficult to extract the plantÕs sugars contained in cellulose and hemicellulose for conversion to transportation fuels.

 

ÒThe real driver for bioenergy is how to get sugar as cheaply as possible from these recalcitrant materials,Ó Wyman said. ÒWeÕre looking for clues as to which traits in these poplar materials will lead to better sugar release.Ó

 

Using a high-throughput screening method, the BESC researchers rapidly analyzed an unprecedented number of poplar core samples in their search to understand the chemical factors that drive sugar yields.

 

The analysis revealed a correlation between one plant trait, the S/G ratio, and increased sugar yields. The ratio refers to the two main building blocks of lignin – syringyl and guaiacyl subunits.

 

"The conventional wisdom is that high lignin contents are bad for sugar release," said lead author Michael Studer. "We unexpectedly found that this statement is only valid for low S/G ratios, while at high S/G ratios lignin does not negatively influence yields. However, replacement of carbohydrates with lignin reduces the maximum possible sugar release."

 

"Another interesting result was that the samples with the highest sugar release belonged to the group with average S/G ratios and lignin contents. This finding points to a need for deeper understanding of cell wall structure before plants can be rationally engineered for efficient biofuels production,Ó Studer said.

 

The teamÕs study also pinpointed certain poplar samples that produced unusually high sugar yields with no pretreatment. Biofuel production typically requires various pretreatments, such as applying high temperature and pressure to the biomass. Reducing pretreatment would represent a substantial decrease in the price of liquid transportation fuels produced from lignocellulosic feedstocks like poplar.

 

ÒIt's very enticing that several of the samples released more sugar than typical with no pretreatment,Ó Wyman said.

 

Poplar trees, botanically known as Populus, represent the leading woody crop candidate for the production of biomass feedstocks for the creation of biofuels in the U.S. Naturally occurring selections of poplar trees contained wide variations in all observed traits, says Gerald Tuskan, an ORNL plant biologist and one of the co-leads of the study.

 

ÒWe can mine this natural variability and find extreme poplar phenotypes that have value in increasing sugar yield,Ó Tuskan said. ÒMoreover, these native individuals are adapted to local environments.Ó

 

From this work, superior poplar cultivars may soon be available for commercial testing and propagation, yielding plant materials that will contribute to reducing the nationÕs dependence on fossil fuel based transportation fuels.

 

The team, supported by BESC at ORNL, included co-lead Mark Davis and Robert Sykes from the National Renewable Energy Laboratory, Jaclyn DeMartini from UCR, and Brian Davison and Martin Keller from ORNL.

 

BESC is one of three DOE Bioenergy Research Centers established by the DOE's Office of Science in 2007. The centers support multidisciplinary, multi-institutional research teams pursuing the fundamental scientific breakthroughs needed to make production of cellulosic biofuels, or biofuels from nonfood plant fiber, cost-effective on a national scale. The three centers are coordinated at ORNL, Lawrence Berkeley National Laboratory and the University of Wisconsin-Madison in partnership with Michigan State University.

 

The Bourns College of Engineering's Center for Environmental Research and Technology (CE-CERT) at UCR is a model for partnerships between industry, government and academia. It is a recognized leader in research and education in the areas of atmospheric processes, emissions and fuels, sustainable energy and transportation systems.

 

ORNL is managed by UT-Battelle for the Department of Energy's Office of Science

 

http://www.seedquest.com/news.php?type=news&id_article=15731&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.40  Promising results for breeding drought-resistant cowpea

 

Cowpea or black-eyed pea has been a source of protein for humans and livestock. The plant can be easily cultured because it is a nitrogen fixer, hence it doesn't need much fertilizer and is resistant to many diseases. Its crude protein which can be up to 30 percent in improved varieties make it an important substitute for animal meat protein during times of high food price and economic crisis.

 

With problems on climate change and agriculture planting patterns, cowpea can be bred to be resistant to drought and high temperatures. Researchers at Texas AgriLife Research are breeding cowpea with these traits in mind and already found one major gene for drought tolerance. Other traits which they hope to improve using germplasm from different sources include short duration and pest resistance.

 

For details of this news, see http://agrilife.org/today/2011/01/31/promising-results-for-breeding-drought-resistant-cowpea/

 

Source: Crop Biotech Update 4 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.41  Two genes better than one for important plant pest

 

Bacterial pathogen Pseudomonas syringae, the causal organism affecting a number of important economic crops such as rice, corn, soybeans, tomatoes, cucumbers, many legumes, and most recently the chestnut trees in the UK, was found to have two genes that code for the 'pili' - the needle-like structure that penetrate and inject a range of disease-causing proteins into plant cells. This finding by researchers from the Imperial College of London led by Jšrg Schumacher, senior author of the study and published in Nature Communications is believed to be a unique evolutionary development for the bacteria's infection mechanism.

 

With this information, researchers will look deeper into the molecular mechanisms on crop pest/host interaction in the hope that a more targeted and sophisticated method of control can be developed in its range of hosts.

 

For more details, see the original article at http://www.bbsrc.ac.uk/news/food-security/2011/110201-pr-two-genes-better-than-one.aspx

 

Source: Crop Biotech Update 4 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++++++

 

1.42  Evaluation of the brown planthopper resistance genes in hybrid rice

 

The brown planthopper (BPH) is one of the most devastating insect pests of rice in Asia. BPH is a sap-feeding insect that causes "hopper-burn" and could also be a vector for rice grassy stunt virus and ragged stunt virus. Use of pesticides to combat this pest is costly and could also cause the decrease in the population of other beneficial insects in the field. Rice variety Shanyou 63, which was widely cultivated in China, has decreased in production due to its susceptibility to pests such as BPH. To increase BPH resistance in rice hybrids like Shangyou 63, Jie Hu of Huazhong Agricultural University, China, and colleagues, used marker-assisted selection introgression of BPH resistance genes (Bph14 and Bph15).

 

Results of the study showed that improved hybrids introgressed with only one gene have enhanced resistance to BPH than the conventional varieties, but those introgressed with both genes have higher resistance. The researchers also found out that both genes are partial dominant genes meaning, no trait is fully dominant over another, thus, the genes could be used to breed BPH-resistant hybrids. Results of the field trials showed that the improved hybrids produce more yield.

 

For more details about this study, visit http://www.springerlink.com/content/d73422711562367n/

 

Source: Crop Biotech Update 18 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++++++++

 

1.43  Global wheat rust project gets US$40 M support

 

The United Kingdom's Department of International Development (DFID) and the Bill & Melinda Gates Foundation will award a US$40 million grant to the Durable Rust Resistance in Wheat (DRRW) project at Cornell University. The grant will support efforts to identify new stem rust resistant genes in wheat, improve surveillance, and multiply and distribute rust-resistant wheat seed to farmers.

 

"We cannot overstate the importance of this announcement on the part of two of the most important funders of solutions for addressing the causes of poverty, hunger and disease in the developing world," said Ronnie Coffman, Cornell professor of plant breeding and genetics and director of the DRRW. "Against the backdrop of rising food prices, and wheat in particular, researchers worldwide will be able to play an increasingly vital role in protecting wheat fields from dangerous new forms of stem rust, particularly in countries whose people can ill afford the economic i! mpact of damage to this vital crop."

 

Partners in the project include national research centers in Kenya and Ethiopia, and scientists at the International Maize and Wheat Improvement Center (CIMMYT), and the International Center for Agricultural Research in the Dry Areas (ICARDA).

 

For more information on DRRW, go to http://www.globalrust.org

 

Source: Crop Biotech Update 04 March 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.44  Release of insect resistant maize hybrids:

 

The Insect Resistant Maize for Africa (IRMA) project recorded a tremendous success in 2010 with the release of six maize varieties. The released varieties are hybrids that have post- harvest and stem borer resistance, which means they are

not susceptible to damage by pests such as the maize weevil and the larger grain borer (LGB). Under the IRMA project, CIMMYT, working alongside the Kenya Agricultural Research Institute (KARI), submitted 12 maize hybrids to the Kenya National Performance Trials (NPT) for testing during 2008-2010.

 

Source: CIMMYT Informa 11 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

++++++++++++++++++++

 

1.45  Cient’ficos espa–oles logran plantas resistentes a diferentes virus inhibiendo un œnico gen

 

Madrid, Spain

March 8, 2011

Un grupo de investigadores del Centro de Edafolog’a y Biolog’a Aplicada del Segura (CEBAS-CSIC), ha desarrollado un mŽtodo para generar variedades de cucurbit‡ceas (familia del mel—n, pepino, sand’a o calabazas) resistentes a varias enfermedades virales. Esto se ha conseguido silenciando un gen de la planta que codifica una prote’na utilizada por el virus en su beneficio para multiplicarse en las cŽlulas vegetales.

 

Segœn recoge la Agencia SINC, la peculiaridad de este mŽtodo es que se obtiene una planta mejorada genŽticamente sin introducir ningœn elemento ajeno a la propia especie. El gen silenciado es utilizado en la replicaci—n de varios tipos de virus, por lo que se obtienen plantas resistentes a varias enfermedades virales, sin necesidad de tratamientos adicionales.

 

Los investigadores han comenzado sus estudios con el mel—n ya que es la especialidad del equipo. De las nueve enfermedades causadas por virus que se han ensayado en plantas de mel—n transgŽnico, en cuatro de ellas las plantas no enfermaban.

 

Este estudio es de gran interŽs ya que las enfermedades v’ricas que afectan a las cucurbit‡ceas causan grandes pŽrdidas econ—micas cada a–o. Adem‡s, Espa–a es un gran exportador del mel—n, entre un 5 y un 10% anual de la producci—n espa–ola.

 

http://www.seedquest.com/news.php?type=news&id_article=15253&id_region=&id_category=&id_crop=

 

Source: Seed!Quest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.46  DNA Markers for Marker-Assisted Breeding

 

March 2011

by Asgar Shir

Modern plant breeding relies heavily on the application of molecular (DNA) markers in selecting superior lines or individuals. Different types of molecular markers are used in the laboratories around the world. IÕm often questioned which marker is the best for marker-assisted selection and my answer is that a good genetic marker should have all or most of the following criteria:

  1. Polymorphic: the essence of the selection is the variability.
  2.  Multiallelic: several alleles at a same locus.
  3.  Codominant: a heterozygous marker shows the characteristics of the two alleles possible in a diploid species.
  4.  None epistatic: no dominance over another marker (no inter-locus interactions).
  5.  Automation: the process can be easily automated to increase the throughput.
  6. Throughput: can multiplex a large number of markers together and run simultaneously.
  7.  Reproducible: Consistent across laboratories.
  8.  Low cost: very important factor in agriculture where thousands of samples are tested.

 

The table below compares the most common markers in plant and animal breeding.

 

RFLPs

RAPDs

AFLPs

SSRs

SNPs

DNA quality

high

high

moderate

moderate

high

PCR based

no

yes

Yes

yes

yes

Polymorphism

moderate

high

High

high

high

Codominant

yes

no

No

yes

yes

Ease to use

not easy

easy

med. easy

easy

easy

Automation

low

moderate

moderate

high

very high

Reproducibility

high

med

High

high

high

Development cost

low

low

moderate

high

high

Cost per analysis

high

low

moderate

low

low

 

According to the criteria above there are 2 PCR-based markers that stand out: SSR (Simple Sequence Repeats) and SNP (Single Nucleotide Polymorphism). In the following section, I will briefly explain each of these markers and highlight the most important characteristics of each one.

 

SSR markers

Simple Sequence Repeat (SSR) or also known as microsatellite or Short Tandem Repeat (STR) is a short repeat of nucleotide sequences that can be mono, di, tri or tetra and up to 7 nucleotides.

 

Examples of such repeats are: (A)n, (TC)n, (TAT)n, (GATA)nÉ, where n indicates the number of repetitions of microsatellite.  Following is an example of a dinucleotide motif (CT) that repeats 7 times.

 

5Õ flanking region                                 Microsatellite locus                            3Õ flanking region

ÉCGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGGÉ

 

 Microsatellites are PCR-based markers that are co-dominant, reproducible and multi-allelic and can be automated to increase throughput. Among all the characteristics of microsatellites perhaps the most important ones are related to breeding application and the fact that they are well dispersed throughout the genome. SSRÕs can also detect multiple alleles for a given locus.  The multi-allelic character of SSR markers makes them a very attractive DNA marker for plant breeding. They can easily detect 10-20 alleles for a given locus in a population.

Description: http://www.eurofinsus.com/ESTA_enews/Mar2011DNAMarkersAsgar_clip_image002.gif 

 

SNP markers

Single Nucleotide Polymorphisms (SNP) is a single base change in a genomic DNA sequence.

1...GATATTCGTACGGATGT-TCCA...

2...GATGTTCGTACTGATGTATCCA...

3...GATATTCGTACGGATGT-TCCA...

4...GATATTCGTACGGATGTATCCA...

5...GATGTTCGTACTGATGTATCCA...

6...GATGTTCGTACTGATGTATCCA...

6 Individuals are classified to 3 distinct Haplotypes: AG– (1 & 3), AGA (4), GTA (2, 5 & 6)

 

SNPs are generally bi-allelic markers meaning there are two alleles that an individual may have for any particular marker. This means that the information content per SNP marker is relatively low when compared to microsatellite markers. It is estimated that it will take approximately 5 SNP markers to equal the information of one microsatellite marker, meaning that ~2,000 SNPs will be required to equal a 10 cM microsatellite map. However, SNPs are abundant in all genomes and can be found approximately every kilobase (1,000 base pairs). They are also spread evenly throughout the genome. This offers the potential for generating very high density genetic maps, which will be extremely useful for developing haplotyping systems for genes or regions of interest. They may be the polymorphisms associated with the gene of interest under study and therefore direct selection of the gene is possible.

 

The types of markers are many and if more information is needed please contact us directly at ESTA and we will be more than happy to answer your questions.

               

http://www.eurofinsus.com/ESTA_enews/Mar2011DNAMarkersAsgar.html

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.47  Cloned seeds show promise for crop breeding

 

Hyderabad, India

March 4, 2011

Seeds have been cloned for the first time, a move which could speed up crop breeding and one day allow farmers to produce their own high-yielding seed.

 

Most crop varieties are hybrids with a mixture of characteristics from genetically distinct parents. But their useful traits are not passed on to their seeds because sexual reproduction, which involves two parents, shuffles genes.

 

Now an international team of scientists has forced plants to produce seeds that are identical to themselves genetically (i.e. cloned), rather than containing a mix of genes from themselves and another parent.

 

The seeds have thus retained all the useful traits of their parent.

Imran Siddiqi, researcher at the Centre for Cellular and Molecular Biology, India, and one of the authors of the paper, published in Science last month(18 February), called this a "proof of principle" of what has long been only a theory.

 

The key to what they have done lies in the fact that some plants naturally reproduce asexually, by 'apomixis', where the offspring are identical to the parent. They have managed to make a plant that usually makes seeds sexually do so by this method instead.

 

Siddiqi said the process involved manipulating 2–4 genes that retain parental genetic material in a seed.

 

He told SciDev.Net that the process would make it possible to 'fix' desirable traits in crops without going through the several generations of cross breeding that are normally required.

 

"This is a real boost to the field of plant genomics as a whole," said Siddiqi. "But application is still a long way off."

 

The method creates clones in around a third of offspring in the model plant species Arabidopsis.

Commercial use would require at least 85–90 per cent of seeds to be successfully cloned, he said.

 

The publication has generated interest among plant scientists in India but they recognise that this is the first step on a long road.

 

P. B. Kirti, professor of plant sciences at the University of Hyderabad, told SciDev.Net that demonstrating that the method works for important crops would be a "huge challenge" and reaching field trials would take years of work and considerable financing.

 

"Getting good genetic material to work on and take this proof of concept further also poses its own challenges, particularly to scientists in developing countries," he added.

 

Siddiqi agreed: "To take this forward would certainly require a more concerted effort — a greater level of funding, a policy-level commitment and wider collaboration."

 

He said provisional patents have been filed for the process. "If and when application becomes a reality, the technology should remain accessible to public institutions."

Link to full paper in Science 

 

http://www.seedquest.com/news.php?type=news&id_article=15186&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

++++++++++++++++++++++++

 

1.48  Arabidopsis anticipates mildew attack in the morning

 

Wei Wang of Duke University and colleagues discovered that Arabidopsis cranks up its immune system in the morning in preparation for the greatest infestation of spores from Hyaloperonospora, a downy mildew. This is the first finding about the plant's defense system cycling on a daily basis even in the absence of pathogens. Since it is expensive to produce chemical compounds that protects Arabidopsis from downy mildew, thus a circadian cycle of production is safer and more efficient.

 

Wang discovered this connection between the circadian clock and plant immunity during their general search for genes linked to the immune system of Arabidopsis. They found 22 genes related to immune response to downy mildew and a number of those genes exhibited rhythmic expression patterns. The expression patterns were monitored and they observed that the defense genes are expressed by schedule even in the absence of pathogens. To test this hypothesis, they exposed th! e plants to mildew spores at dawn and at dusk and infection rates were found to be higher during dusk.

 

They used "clock mutants" that lack the circadian clock regulator (CCA1) and results show that these mutants had higher infection rates than normal plants.

 

Read more details at http://www.nature.com/nature/journal/v470/n7332/full/nature09766.html

 

Source: Crop Biotech Update 4 February 2011

 

Contributed by Margaret Smith

Dept of Plant Breeding and Genetics, Cornell University

Mes25@cornell.edu

 

(Return to Contents)

 

+++++++++++++++++++++++

 

1.49  Phytochemicals of Brassicaceae in plant protection and human health – Influences of climate, environment and agronomic practice

 

Maria Bjorkman a,1, Ingeborg Klingen a,,1, Andrew N.E. Birch b, Atle M. Bones c, Toby J.A. Bruce d, Tor J. Johansen e, Richard Meadow a, Jorgen Molmann e, Randi Seljasen f, Lesley E. Smart d, Derek Stewart b

 

a Norwegian Institute for Agricultural and Environmental Research (Bioforsk), Plant Health and Plant Protection Division, H¿gskoleveien 7, N-1432 s, Norway

b Scottish Crop Research Institute (SCRI), Invergowrie, Dundee, DD2 5DA Scotland, UK

c Norwegian University of Science and Technology (NTNU), Department of Biology, NO-7491 Trondheim, Norway

d Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK

e Norwegian Institute for Agricultural and Environmental Research (Bioforsk), Arctic Agriculture and Land Use Division, P.O. Box 2284, 9269 Troms¿, Norway

f Norwegian Institute for Agricultural and Environmental Research (Bioforsk), Arable Crop Division, 4886 Grimstad, Norway

 

Received 25 June 2010

Received in revised form 13 December 2010

 

Keywords:

Carotenoids, Environmental factors, Epicuticular waxes, Glucosinolates, Human health, Integrated pest management, Polyphenolics, Secondary metabolites,Tocopherols

 

A b s t r a c t

In this review, we provide an overview of the role of glucosinolates and other phytochemical compounds present in the Brassicaceae in relation to plant protection and human health. Current knowledge of the factors that influence phytochemical content and profile in the Brassicaceae is also summarized and multi-factorial approaches are briefly discussed. Variation in agronomic conditions (plant species, cultivar, developmental stage, plant organ, plant competition, fertilization, pH), season, climatic factors, water availability, light (intensity, quality, duration) and CO2 are known to significantly affect content and profile of phytochemicals. Phytochemicals such as the glucosinolates and leaf surface waxes play an important role in interactions with pests and pathogens. Factors that affect production of phytochemicals are important when designing plant protection strategies that exploit these compounds to minimize crop damage caused by plant pests and pathogens. Brassicaceous plants are consumed increasingly for possible health benefits, for example, glucosinolate-derived effects on degenerative diseases such as cancer, cardiovascular and neurodegenerative diseases. Thus, factors influencing phytochemical content and profile in the production of brassicaceous plants are worth considering both for plant and human health. Even though it is known that factors that influence phytochemical content and profile may interact, studies of plant compounds were, until recently, restricted by methods allowing only a reductionistic approach. It is now possible to design multi-factorial experiments that simulate their combined effects. This will provide important information to ecologists, plant breeders and agronomists.

 

2011 Elsevier Ltd. All rights reserved

 

Contributed by Nick Birch

Scottish Crop Research Institute (SCRI)

Nick.Birch@scri.ac.uk

 

(Return to Contents)

 

+++++++++++++++++++++

 

1.50  How do plants fight disease?

 

Breakthrough research by UC Riverside plant pathologist offers a clue

 

Riverside, California, USA

March 28, 2011

How exactly bacterial pathogens cause diseases in plants remains a mystery and continues to frustrate scientists working to solve this problem. Now Wenbo Ma, a young plant pathologist at the University of California, Riverside, has performed research on the soybean plant in the lab that makes major inroads into our understanding of plant-pathogen interactions, a rapidly developing area among the plant sciences.

 

Her breakthrough research can help scientists come up with effective strategies to treat crops that have succumbed to disease or, when used as a preventative measure, to greatly reduce their susceptibility to disease.

 

In a paper published in the March issue of the journal Cell Host & Microbe, Ma, an assistant professor of plant pathology and microbiology, and her colleagues show that the bacterial pathogens target isoflavones, a group of compounds in plant cells that defend the plant from bacterial infection, resulting in a reduction in isoflavone production.

 

An arms race

First, the pathogens inject virulence bacterial proteins, called HopZ1, through needle-like conduits into the plant cells. These proteins then largely reduce the production of the isoflavones and promote disease development. However, by sensing the presence of HopZ1, the plants mount a robust resistance against the pathogen, including the production of a very high amount of isoflavones. At this point, the pathogen must come up with new strategies by either changing the kind of proteins it injects into the plant, not injecting any proteins at all, or injecting virulence proteins in a way that helps them escape detection by the plant. In this way, the virulence bacterial proteins and the plant host engage in an endless Òarms race.Ó

 

ÒOne question we are still trying to answer is how at the molecular level the bacterial virulence proteins promote disease,Ó Ma said. ÒSome scientists have shown that these proteins block signaling transduction pathways in the plant, which eventually weakens plant immunity. We are introducing a fresh perspective on this topic, namely, that the pathogens evolved strategies to directly attack the production of plant antimicrobial compounds, such as isoflavones, thus compromising the plantÕs defense mechanism.Ó

 

Closing the circle

According to Ma, her results can be extrapolated to understand how plants defend themselves when attacked by pathogens. She is pleased to be resuming research first studied by UC RiversideÕs Noel Keen, the late plant scientist and a pioneer in molecular plant pathology, who did fundamental groundbreaking work on understanding how isoflavones and isoflavone-derived compounds play a role in defending plants against microbial infection.

 

ÒThis was an important topic of study about 30 years ago, but then the topic was dropped by researchers and it lost momentum,Ó Ma said. ÒMy lab is now revisiting the problem. Of course, we still have many questions to answer. We need to fully understand how isoflavones function to protect plants so that we can design specific strategies aimed at better protecting the plant.Ó

 

Looking forward

MaÕs lab is also interested in understanding what makes pathogens what they are. Why is it that among ecologically similar bacteria, some cause disease while others do not? Her lab is also studying how plants evolve mechanisms to protect themselves from infection, how pathogens subvert this defense and become virulent again.

 

ÒPathogens get wise to the disease-fighting strategies we use in agriculture,Ó Ma said. ÒThis is evolution at work. But with fundamental knowledge on how pathogens cause disease we can develop sustainable and applicable strategies to combat disease.Ó

 

About Wenbo Ma

Ma received her doctoral degree in biology in 2003 at the University of Waterloo, Canada. Thereafter, she did postdoctoral research for three years at the University of Toronto, Canada. She joined UCR in 2006. Her awards and honors include a RegentsÕ Faculty Fellowship at UCR, a postdoctoral fellowship from the Natural Sciences and Engineering Research Council of Canada, and the W.B. Pearson Medal from the University of Waterloo.

 

She chose the soybean plant to study because the pathogen she was interested in, Pseudomonas syringae, attacks the soybean plant. Soybean is the second largest crop and the largest agricultural export in the United States. In addition to being an important human and animal food crop, it is also a major feedstock for biodiesel.

 

Ma was joined in the research by UCRÕs Huanbin Zhou (first author of the research paper and a postdoctoral researcher in the Ma group), Jian Lin, Aimee Johnson, Robyn Morgan and Wenwan Zhong. Zhong is an assistant professor in the Department of Chemistry.

 

The research study was supported by grants from the National Science Foundation, UCR-Los Alamos National Laboratory collaborative program for plant diseases and the U.S. Department of Agriculture Experimental Station Research Support Allocation Process.

 

http://www.seedquest.com/news.php?type=news&id_article=15751&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

========================= 

 

2  PUBLICATIONS

 

2.01 New book: ÔBreeding crops with resistance to diseases and pestsÕ

 

Wageningen, The Netherlands

March 2, 2011

The book ÔBreeding crops with resistance to diseases and pestsÕ was published on 1 March. The book provides important up-to-date information about plant-pathogen principles for plant breeders who wish to introduce resistance to diseases and pests into their crops.

 

A large part of the book deals with the many options that are open to breeders: testing seedlings or mature plants for resistance? In the greenhouse or in the field? With a mixture of pathogen strains or with a pure strain? Each of those choices has its advantages and disadvantages and these are discussed in clear terms.

 

The book contains numerous examples, further details and interesting exceptions, and these are typographically easily distinguishable from the main text; this makes it easy for students to separate main issues and side issues. The book also contains many self-test exercises with the answers and further information in the back of the book. The book also contains a terminology list with definitions.

 

ÔBreeding crops with resistance to diseases and pestsÕ is not only of interest to students but also to practical plant breeders working in companies and institutions who are planning to set up a breeding programme for resistance.

 

This book fills a gap because an academic textbook on this subject had not been published until now. From now on it will be used in the lectures given by the Plant Breeding Chair Group.

 

ÔBreeding crops with resistance to diseases and pestsÕ has been written by four authors with a lot of experience and expertise in resistance research of the Plant Breeding Chair Group of Wageningen University: Rients Niks (photo), Jan Parlevliet, Pim Lindhout and Yuling Bai. The book can be ordered from Wageningen Academic Publishers.

 

More information and ordering

 

http://www.seedquest.com/news.php?type=news&id_article=15145&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++++++++

 

2.02  FAO policy guide: Promoting the Growth and Development of Smallholder Seed Entrprises for Food Security Crops

 

1 March 2011, Rome – Small seed enterprises are the best way of ensuring the availability and quality of non-hybrid seeds for food and feed crops in developing countries, said FAO in a policy guide published today.

 

According to the World Bank, up to 50 percent of crop yield increases have come from improved seeds, while farmers' access to quality seeds is a key factor for better food and nutrition in poor countries.   

 

In recent years, however, a large number governments in the developing world reduced public investment in the seed sector, the expectation being that the private sector would fill the gap.

 

In many places, especially Africa, this has not happened as medium and large seed companies tend to concentrate on producing hybrid seed for high value crops grown by larger farmers and market them in more fertile, wealthier areas.

 

Sharing not enough

 

As a result, only about 30 percent of smallholder farmers in developing countries use seed of improved varieties of variable quality — in Africa the percentage is smaller still.

 

Hybrid seeds provide better yields and disease resistance but cannot be saved by farmers for the next planting, as the hybrid plant seeds do not reliably produce true copies. 

 

The majority of poor smallholder farmers growing food security crops such as sorghum, millet and cassava rely on self or open-pollinated seeds or crops that are propagated through dividing bulbs, or taking cuttings stored from previous harvests and grafting them.

 

However, they do not always have access to new varieties that can help them increase production using the same amount of inputs.

 

"It doesnÕt cost a lot comparatively to set up a seed enterprise, especially when it involves local farmers' organizations, but as case studies in the policy guide from three continents have shown, such enterprises can be highly effective in improving food output," said Shivaji Pandey, Director of FAOÕs Plant Production and Protection Division.

 

Brazil, India, Cote DÕIvoire

 

The policy guide, entitled ÒPromoting the Growth and Development of Smallholder Seed Enterprises for Food Security CropsÓ, is based on case studies from Brazil, India and C™te d'Ivoire, the results of which have been published separately by FAO.

 

In all three cases, a favorable policy environment was found to be a key requirement to the successful development of smallholder seed enterprises. 

 

Examples include an efficient quality control and certification system, private sector support, flexible legislation and the legal recognition of the rights of farmers to save, exchange and sell seeds of commercial varieties. 

 

Private sector support

 

Support for privatization and commercialization of agricultural services and the support of plant breeder rights are also imperative. Other factors that can help farmers set up small-scale seed enterprises include reduced tariffs for the import of seed-cleaning and other equipment, key to establishing a seed industry, as adopted by the government of C™te d'Ivoire.

 

Credit must also be available to seed producers; lack of credit was seen as a major hindrance to seed enterprise development and seed producers should be given assistance to run marketing and communications campaigns including the use of rural radio networks to advertise improved varieties to farmers.

 

Marketing help

 

"Sometimes the seed is there but farmersÕ organizations need assistance and guidance in marketing it to other farmers," said Pandey. Many small-scale seed enterprises have been developed with the support of donors or NGOs but this can lead to aid dependency if both technical and entrepreneurial capacities are not developed for self-reliance, the FAO document warns.

 

It is hoped that legislation governing seeds for the whole of Africa will eventually be harmonized to make it easier for new varieties to cross borders. This is of particular importance because of climate change which is increasing the need for more resilient varieties.

 

Therefore, new hybrid seed must be purchased for each planting. The seed of self-pollinated crops (wheat and beans, for example) can be saved by farmers for next planting.

 

Generally speaking, seed purchased from qualified and reliable seed producers is better in purity, germination and overall quality regardless of whether is hybrid or non-hybrid seed.

 

http://www.fao.org/news/story/tr/item/51581/icode/en/

 

http://www.fao.org/agriculture/crops/core-themes/theme/seeds-pgr/en/

 

 

Contributed by Kakoli Ghosh

Programme Entity Leader

AGP - Seeds and Plant Genetic Resources

Kakoli.ghosh@fao.org

 

(Return to Contents)

 

+++++++++++++++++++++++++++

 

2.03  New publication on the origin of and centers of diversity of maize in Mexico

 

Elementos para la determinaci—n de centros de origen y centros de diversidad genŽtica para el caso de los ma’ces de MŽxico a partir de los resultados del proyecto ÒRecopilaci—n, generaci—n, actualizaci—n y an‡lisis de informaci—n acerca de la diversidad genŽtica de ma’ces nativos y sus parientes silvestres en MŽxicoÓ (2006-2011).

 

http://www.biodiversidad.gob.mx/genes/pdf/proyecto/Elementos_recursosGeneticos_maices.pdf

 

Coordinaci—n de An‡lisis de Riesgo y Bioseguridad

CONABIO

Parques del Pedregal

Tlalpan 14010, MŽxico D.F.

carb@conabio.gob.mx

 

(Return to Contents)

 

 

3.  WEB AND NETWORKING RESOURCES

 

3.01  Information on seeds from FAO

 

On the Seed-PGRFA website of FAO you can now find information on a new handbook on Seeds in Emergencies as well as an article from FAO media center regarding a recent publication on Small Seed Enterprises.  

 

Please visit http://www.fao.org/agriculture/crops/core-themes/theme/seeds-pgr/en/

 

 (Return to Contents)

 

 

4.  GRANTS AND AWARDS

 

4.01  Wanted: global rice science scholars

 

The Philippines

March, 2011

If you are about to enroll or conduct your Ph.D. research, you could be one of a new generation of rice scientists with a Global Rice Science Scholarship (GRiSS).

 

The 2011 GRiSS offers young agricultural scientists the chance to be experts in a scientific discipline and to have a broader understanding of global issues that affect rice science for development.

 

This is a great opportunity for scientists early in their career who are working in a national agricultural research and extension system in developing countries. 

 

Research areas covered by the scholarship include rice science and related systems research, particularly on agronomy, crop physiology, entomology, plant pathology, soil and water science,plant breeding, and the social sciences.

 

GRiSS falls under the framework of the Global Rice Science Partnership (GRiSP), a single strategic goal and work plan for global rice research. GRiSP is led by IRRI and involves other centers under the Consultative Group on International Agricultural Research.

 

http://www.seedquest.com/news.php?type=news&id_article=15232&id_region=&id_category=&id_crop=

 

Source: SeedQuest.com

 

(Return to Contents)

 

+++++++++++++++++++++

 

4.02  OWSDW Prizes 2011 for young women scientists in developing countries (second call)

 

The 2011 call for applications is open

 

With the support of TWAS and the Elsevier Foundation prizes of US$5,000 will be awarded to the best young female scientists in three categories (biology, chemistry and physics/mathematics) from each of the four regions of the developing world (Africa, Arab region, Asia and the Pacific, Latin America and the Caribbean).

 

See the OWSDW website www.owsdw.org to download the Prize Nomination form

 

Contact details:

Organization for Women in Science for the Developing World OWSDW

c/o TWAS - the academy of sciences for the developing world

ICTP Campus - Strada Costiera, 11 - 34151 Trieste - Italy

info@twows.org

 

(Return to Contents)

 

+++++++++++++++++++++

 

4.03  TWAS South-South Fellowships Programme

 

The Academy of Sciences for the Developing World (TWAS) is promoting  various fellowship programmes for PhD, Postdoctoral and Advanced  Research. These schemes represent a great opportunity for scientists and  researchers who may be interested in enhancing their scientific  knowledge.

 

The fellowships are overseen jointly by TWAS and various host institutes  in countries in the South, including Brazil, Pakistan, China and India  and they allow scientists from developing countries to study or do  research in other developing countries and then to return home to continue their careers.

 

TWAS Fellowships: 2011 Call for Applications Postgraduate, postdoctoral, visiting scholar and advanced research  fellowships available to scientists from developing countries

 

TWAS, the academy of sciences for the developing world, is now accepting  applications for its postgraduate, postdoctoral, visiting scholars and  advanced research fellowship programmes.

 

The fellowships are offered to scientists from developing countries and  are tenable at centres of excellence in various countries in the South,  including Brazil, China, India, Kenya, Malaysia, Mexico, Pakistan and  Thailand.

 

Eligible fields include: agricultural and biological sciences, medical  and health sciences, chemistry, engineering, astronomy, space and earth sciences, mathematics and physics.

 

 

Women scientists are especially encouraged to apply.

 

Mara Marchesan

TWAS Fellowships Office

TWAS, the academy of sciences for the developing world

http://www.twas.org

 

The TWAS South-South Fellowships Programme provides over 300 fellowships each year tenable in developing countries such as Brazil, China, India, Kenya, Malaysia, Mexico, Pakistan and Thailand for scientists from developing countries. Fellowships, for various lengths of time, are available for postgraduate, postdoctoral and advanced research. Brief details of each programme are provided below. Please see www.twas.org > Programmes > Exchange > Fellowships (http://twas.ictp.it/prog/exchange/fells/fells-overview) for the latest  information regarding all these programmes, including eligibility  criteria, deadlines, etc, and to download the application forms and guidelines.

 

Fellowships for Postgraduate Training

TWAS-CNPq Fellowships for Postgraduate Research in Brazil

The National Council for Scientific and Technological Development (CNPq) and TWAS offer fellowships for scientists from developing countries (other than Brazil) who wish to pursue all or part (SANDWICH or FULL-TIME) of their research leading towards a PhD in the natural sciences.

Duration: up to 4 years Deadline for applications: 30 June each year Age limit: 35

 

TWAS-CAS Fellowships for Postgraduate Research in China

The Chinese Academy of Sciences (CAS) and TWAS offer fellowships for students from developing countries (other than China) who wish to undertake the final year of their PhD research in the naturalsciences.

Duration: 1 year Deadline for applications: 31 August each year Age limit: 35

TWAS-CSIR Fellowships for Postgraduate Studies in India

 

The Council of Scientific and Industrial Research (CSIR) and TWAS offer fellowships for scientists from developing countries (other than India) who wish to obtain a PhD in newly emerging areas inscience and technology. SANDWICH and FULL-TIME fellowships available.

Duration: up to 4 years Deadline for applications: 31 August each year Age limit: 35

TWAS-DBT Biotechnology Fellowships for Postgraduate Studies in India

 

The Department of Biotechnology, Government of India (DBT) and TWAS offer fellowships for scientists from developing countries (other than India) who wish to obtain a PhD in biotechnology. SANDWICH and FULL-TIME fellowships available.

Duration: up to 5 years Deadline for applications: 31 August each year Age limit: 30

 

TWAS-S.N. Bose Fellowships for Postgraduate Studies in India

The S.N. Bose National Centre for Basic Sciences (S.N. Bose) and TWAS offer fellowships for scientists from developing countries (other than India) who wish to obtain a PhD in the physical sciences. SANDWICH and FULL-TIME fellowships available.

Duration: up to 4-5 years Deadline for applications: 31 August each year Age limit: 35

 

TWAS-IACS Fellowships for Postgraduate Research in India

The Indian Association for the Cultivation of Science (IACS) and TWAS offer fellowships for scientists from developing countries (other than India) who wish to obtain a PhD in a field of natural sciences.

Duration: up to 4 years Deadline for applications: 30 June each year Age limit: 30

 

TWAS-icipe Fellowships for Postgraduate Research in Kenya

The International Centre of Insect Physiology and Ecology (icipe) and TWAS offer fellowships for scientists from developing countries (other than Kenya) who wish to obtain a PhD in the naturalsciences, especially focusing on integrated control methodologies for crop and livestock insect pests and other related arthropods, and insect vectors of tropical diseases.

Duration: up to 3 years Deadline for applications: 15 September each year Age limit: 35

 

TWAS-USM Fellowships for Postgraduate Research in Malaysia

The Universiti Sains Malaysia (USM) and TWAS offer fellowships for scientists from developing countries (other than Malaysia) who wish to obtain a PhD in the natural sciences.

Duration: up to 3 years. Deadline for applications: 15 September each year Age limit: 35

 

TWAS-CONACYT Fellowships for Postgraduate Research in Mexico

The National Council on Science and Technology (CONACYT) and TWAS offer fellowships for scientists from developing countries (other than Mexico) who wish to obtain a PhD in the natural sciences.

Duration: up to 4 years Deadline for applications: 30 June each year Age limit: 30

 

TWAS-CEMB Fellowships for Postgraduate Research in Pakistan

The Centre of Excellence in Molecular Biology (CEMB) and TWAS offer fellowships for scientists from developing countries (other than Pakistan) who wish to obtain a PhD in molecular biology and molecular genetics. SANDWICH and FULL-TIME fellowships available.

Duration: up to 4 years Deadline for applications: 30 June each year Age limit: 35

 

TWAS-ICCBS Fellowships for Postgraduate Research in Pakistan

The International Center for Chemical and Biological Sciences (ICCBS) and TWAS offer fellowships for scientists from developing countries (other than Pakistan) who wish to obtain a PhD in chemical or biological sciences. SANDWICH and FULL-TIME fellowships available.

Duration: up to 4 years Deadline for applications: 30 June each year Age limit: 35

 

Fellowships for Postdoctoral Research

TWAS-CNPq Fellowships for Postdoctoral Research in Brazil

CNPq and TWAS offer fellowships to scientists from developing countries (other than Brazil) who wishto pursue postdoctoral research in natural sciences.

Duration: 6 to 12 months Deadline for applications: 30 June each year Age limit: 45

 

TWAS-CAS Fellowships for Postdoctoral Research in China

CAS and TWAS offer fellowships to scientists from developing countries (other than China) who wish to pursue postdoctoral research in natural sciences.

Duration: 6 to 12 months Deadline for applications: 31 August each year Age limit: 40

 

TWAS-CSIR Fellowships for Postdoctoral Research in India

CSIR and TWAS offer fellowships to scientists from developing countries (other than India) who wish to pursue postdoctoral research in newly emerging areas in science and technology.

Duration: 6 to 12 months Deadline for applications: 31 August each year Age limit: 45

 

TWAS-DBT Biotechnology Fellowships for Postdoctoral Research in India

DBT and TWAS offer fellowships to scientists from developing countries (other than India) who wish to pursue postdoctoral research in biotechnology.

Duration: 12 to 18 months Deadline for applications: 31 August each year Age limit: 40

 

TWAS-S.N. Bose Fellowships for Postdoctoral Research in India

S.N. Bose and TWAS offer fellowships to scientists from developing countries (other than India) who wish to pursue postdoctoral research in the physical sciences.

Duration: 6 to 12 months Deadline for applications: 31 August each year Age limit: 45

 

TWAS-IACS Fellowships for Postdoctoral Research in India

IACS and TWAS offer fellowships to scientists from developing countries (other than India) who wish to pursue postdoctoral research in the natural sciences.

Duration: 6 to 12 months Deadline for applications: 30 June each year Age limit: 40

 

TWAS-icipe Fellowships for Postdoctoral Research in Kenya

The International Centre of Insect Physiology and Ecology (icipe) and TWAS offer fellowships for scientists from developing countries (other than Kenya) who wish to pursue postdoctoral research in the natural sciences, especially focusing on integrated control methodologies for crop and livestock insect pests and other related arthropods, and insect vectors of tropical diseases.

Duration: 6 to 12 months Deadline for applications: 15 September each year

No age limit, but application must be made within 5 years (or less) of obtaining PhD.

 

TWAS-USM Fellowships for Postdoctoral Research in Malaysia

USM and TWAS offer fellowships to scientists from developing countries (other than Malaysia) who wish to pursue postdoctoral research in the natural sciences.

Duration: 1 to 3 years Deadline for applications: 15 September each year

No age limit, but application must be made within 5 years (or less) of obtaining PhD.

 

TWAS-CONACYT Fellowships for Postdoctoral Research in Mexico

The National Council on Science and Technology (CONACYT) and TWAS offer fellowships to scientists from developing countries (other than Mexico) who wish to pursue postdoctoral research in the natural sciences.

Duration: 6 to 12 months Deadline for applications: 30 June each year Age limit: 40

 

TWAS-CEMB Fellowships for Postdoctoral Research in Pakistan

CEMB and TWAS offer fellowships to scientists from developing countries (other than Pakistan) who wish to pursue postdoctoral research in molecular biology and molecular genetics.

Duration: 6 to 12 months Deadline for applications: 30 June each year Age limit: 45

 

TWAS-ICCBS Fellowships for Postdoctoral Research in Pakistan

ICCBS and TWAS offer fellowships to scientists from developing countries (other than Pakistan) who wish to pursue postdoctoral research in chemical or biological sciences.

Duration: 6 to 12 months Deadline for applications: 30 June each year Age limit: 45

 

TWAS-BIOTEC Fellowships for Postdoctoral Research in Thailand

BIOTEC and TWAS offer fellowships to scientists from developing countries (other than Thailand) who wish to pursue postdoctoral research in biotechnology.

Duration: 12 to 24 months Deadline for applications: 15 September each year

No age limit, but application must be made within 5 years (or less) of obtaining PhD.

 

TWAS Fellowships for Research and Advanced Training

TWAS provides travel support for scientists from developing countries to carry out research at aresearch institution in a developing country (other than the home country).

Duration: 3-12 months Deadline for applications: 1 October each year No age limit

 

TWAS-CAS Fellowships for Visiting Scholars in China

CAS and TWAS offer fellowships to scientists from developing countries (other than China) who wish to pursue advanced research in the natural sciences.

Duration: 1-3 months Deadline for applications: 31 August each year Age limit: 55

 

TWAS-icipe Fellowships for Visiting Scholars in Kenya

The International Centre for Insect Physiology and Ecology (icipe) and TWAS offer fellowships for scientists from developing countries (other than Kenya) who wish to pursue advanced research in the natural sciences, especially focusing on integrated control methodologies for crop and livestock insect pests and other related arthropods, and insect vectors of tropical diseases.

Duration: 1-3 months Deadline for applications: 15 September each year Age limit: 55

 

TWAS-USM Fellowships for Visiting Researchers in Malaysia

USM and TWAS offer fellowships to scientists from developing countries (other than Malaysia) who wish to pursue advanced research in the natural sciences.

Duration: 1-3 months Deadline for applications: 15 September each year Age limit: 55

 

TWAS Fellowships Office

Contact details:

ICTP campus

Strada Costiera 11

34151 Trieste, Italy

Email: fellowships@twas.org

 

(Return to Contents)

 

+++++++++++++++++++++

 

4.04  Awards nominations requested from the National Association of Plant Breeders (NAPB) (USA)

 

Help us recognize exceptional contributions to plant breeding by taking a few moments to submit nominations.

 

Lifetime Achievement Award (distinguished long-term service to plant breeding)

 

Early Career Scientist Award (excellence of early-career performance).

 

Nomination instructions are the NAPB Web site: http://www.plantbreeding.org/napb/Awards/Awards.html

 

(Return to Contents)

 

 

5.  POSITION ANNOUNCEMENTS

 

5.01  Job Description: Hot Pepper Breeder (Vegetables Division)-002ED

 

Description

Monsanto is seeking a highly motivated individual to become an integral member of a multidisciplinary, global Hot pepper breeding team.  This is a superb opportunity to manage a breeding program in collaboration with a large, multidisciplinary global research team to obtain successful new products. As a breeder you will have primary responsibilities for the development of new and improved Hot pepper hybrids and management of the pre-commercial product pipeline for targeted global market segments. A significant amount of interaction and collaboration is expected with other pepper breeders, breeding technology, pathology, foundation/stock seed, technology development, and the commercial organization.  You will also manage design, development, and implement breeding research projects in collaboration with plant pathologists, food chemists, breeding technology. You will be directly responsibility for managing your breeding staff and budget.

 

You will directly interact with the vegetable breeding, breeding technology, and trait development scientists and serve as a key member of the technology development pipeline.  The Culiacan, Sinaloa Mexico location is a major vegetable R&D center in Mexico. This role offers the prospect to work with the world's largest global agronomic and vegetable breeding organization that possesses state of the art breeding application tools and analytical platforms. This provides opportunities for development of novel breeding approaches/methodologies or the creative application of existing methods for the enhancement of peppers.

 

Responsibilities:

  • Direction and management of all components of a successful commercial hot pepper breeding program, including, but not limited to:  (a) creating and evaluating breeding populations; (b) utilizing marker-assisted breeding to increase breeding program efficiency and scale and accelerate the development of novel products (hybrids) to the market; (c) coordinate, place, and evaluate trials in major global market segments; (d) make line and hybrid advancement decisions; (e) fulfill requirements for variety advancement through documentation of performance; and (f) completion of required breeder's seed.
  • Conduct breeding and screening tests of lines and hybrids at Monsanto and off-station breeding sites that may require travel for up to 25% of the time out of home base
  • Utilization of all relevant breeding technologies with appropriate allocation of resources directed at the successful development of commercial products for key global market segments.
  • Through engagement and collaborative interaction with breeding technology communities across Monsanto, identify, research, and apply approaches that enhance breeding program effectiveness and efficiency.  
  • Achieve pre-commercial hybrid advancement targets and make recommendations to appropriate regional crop teams.  
  • Travel to key global market segments required for trial and product evaluations.
  • Ensure that the research team is trained and compliant with Monsanto Environmental Safety and Health (ESH) policies to ensure safe operations of the research program.
  • Manage research budgets and appropriately allocate resources to meet near- and long-term goals.
  • Recruit, train, and develop research support personnel.

Qualifications

 

Required Skills/Experiences:

  • PhD in Plant Breeding, Genetics or related field of study.
  • Strong background in plant breeding, genetics, field plot technique and statistical analysis, and marker-assisted breeding approaches.
  • Demonstrated success in technical proficiency, scientific creativity, and collaboration with others.
  • Excellent managerial and organizational skills and ability to multitask and achieve milestones.
  • Ability to work in a team based environment with multidisciplinary teams.
  • Effective verbal and written communication skills.
  • Leadership capabilities within the technology community that can extend into other functional areas.
  • Strong computer skills, particularly with Microsoft Office applications, but also the capacity to learn and work with Monsanto proprietary breeding software 
  • Spanish and English language fluency required.

Desired Skills / Experience:

  • 3+ years experience working in breeding/genetics.
  • Vegetable crop research experience. 
  • Knowledge of quantitative genetics, genomics, statistical genetic theory and practice, and experimental design, particularly as they are applied to plant breeding.

Job

 Research & Development

Primary Location

Latin America-Mexico-Sinaloa-Los Mochis

Organization

 R&D Americas_51070580

Schedule

 Full-time

 

Visit www.monsanto.com/careers for additional information and opportunities

 

Contributed by Donn Cummings

Global Breeder Sourcing Lead, Monsanto

donn.cummings@monsanto.com

 (Return to Contents)

 

 

6. MEETINGS, COURSES AND WORKSHOPS

 

New listings may include some program details, while repeat listings will include only basic information. Visit web sites for additional details.

 

This section includes three subsections:

A.    DISTANCE LEARNING/ONLINE COURSES

B.    COURSES OF THE SEED BIOTECHNOLOGY CENTER AT UC DAVIS

C.   OTHER MEETINGS, COURSES AND WORKSHOPS

 

A.    DISTANCE LEARNING/ONLINE COURSES

 

Online Graduate Program in Seed Technology & Business

Iowa State University

http://click.icptrack.com/icp/relay.php?r=48323218&msgid=597705&act=BDP

 

The Iowa State University On-line Graduate Program in Seed Technology and Business develops potential into managerial leadership.

 

Seed industry professionals face ever-increasing challenges. The Graduate Program in Seed Technology and Business (STB) at Iowa State University provides a unique opportunity for seed professionals to grow by gaining a better understanding of the science, technology, and management that is key to the seed industry.

 

The STB program offers a Masters of Science degree as well as graduate certificates in Seed Science and Technology and in Seed Business Management. Science and technology curriculum includes courses in crop improvement, seed pathology, physiology, production, conditioning, and quality. Business topics include accounting, finance, strategy, planning, management information systems, and marketing and supply chain management--including a unique new course in seed trade, policy, and regulation.

 

Contact us today for more information about how you can apply.