PART IV - APPENDIXES

Appendix 1. Preparation of hyperimmune anti-rinderpest serum in rabbits
Appendix 2. Stock solutions
Appendix 3. Fifty percent effective dose (ED50): Spearman-Kärber method
Appendix 4. Formulae for calculating Tm and oligonucleotide concentration
Bibliography

Appendix 1. Preparation of hyperimmune anti-rinderpest serum in rabbits

The essential diagnostic reagent for detecting rinderpest-specific antigens is hyperimmune anti-rinderpest serum prepared by multiple inoculations of viral suspensions, with or without incorporated adjuvants, into a suitable donor. The ideal system, which avoids concurrent production of non-rinderpest antibodies, is hyperimmune anti-rinderpest serum prepared in rabbits, using as the virus inoculum suspensions of lymphoid organs from rabbits infected with a rabbit-adapted strain of the virus (Scott and Brown, 1961). The best strain is the Japanese substrain of the Nakamura III lapinized strain, which readily infects rabbits but does not kill them. The widely used Kabete substrain is lethal for rabbits and, if used, the rabbits must be protected either actively, two weeks before, by a prior inoculation of avianized-lapinized rinderpest virus, or passively, 24 hours before, by intravenous injection of hyperimmune anti-rinderpest rabbit serum at the rate of 2.0 ml of serum per kilogram of body weight.

Alternatively, if lapinized rinderpest virus is not available, rabbits can be hyperimmunized by Freund's complete adjuvant emulsified with an antigen-antibody precipitate. It is produced in an agar gel by diffusing antigen harvested from cell cultures infected with the attenuated rinderpest vaccine virus strain against previously obtained hyperimmune anti-rinderpest rabbit serum.

A second alternative of particular interest to diagnosticians in countries where rinderpest was previously unknown is the use of antiserum raised in pigs by multiple intranasal inoculations of canine distemper virus (CDV) (Zaghara, Liess and Frey, 1990). When the anti-CDV immuno-globulin was conjugated with peroxidase, the labelled preparation detected rinderpest virus grown in Vero cells as well as CDV and phocine distemper viruses.

Equipment

Ultrasonicator. Not essential but eases the task of harvesting antigen from infected cell cultures.

Syringes. 1-, 5- and 20-ml syringes with a supply of 18- and 23-gauge hypodermic needles.

Dissecting instruments. Scalpels, scissors and forceps.

Balance. Designed to weigh up to 100 g.

Homogenizer. Mortar, pestles and sand or an electric blender.

Centrifuge. Bench-top centrifuge complete with centrifuge tubes.

Freezer. Set to run between -15°C and -20°C.

Freeze-drier. Not essential, but its use to preserve antiserum obviates the need for a refrigerator.

Animals and reagents

Rabbits. Any breed of domesticated European rabbits (Oryctolagus cuniculus L.) over four months of age.

Anti-rinderpest serum. Hyperimmune anti-rinderpest serum prepared in rabbits.

Virus strains. The Japanese or Kabete substrains of the Nakamura III strain of lapinized rinderpest virus, the avianized-lapinized strain and the cell culture-adapted attenuated RBOK strain.

Diluent. PBSA.

Anaesthetic. Thiopentone sodium BP (Vet).

Anticoagulant. EDTA dipotassium salt.

Antibiotics. Stock solutions of penicillin G containing 200 000 units per millilitre and streptomycin sulphate containing 500 000 m g per millilitre.

Adjuvants. Freund's complete and incomplete adjuvants.

Petroleum jelly. Yellow soft paraffin.

Silicone solution. 2 percent dimethyl dichlorosilane solution in 1,1,1-trichloroethane.

Preparation of reagents

Virus stockpile. A stock of lapinized rinderpest virus is prepared as follows:

1. Reconstitute the contents of a vial of freeze-dried suspension of lapinized rinderpest virus with 20 ml cold PBSA.

2. Inoculate 1 ml of the reconstituted virus suspension slowly into the marginal ear vein of up to ten numbered rabbits, using a 23-gauge hypodermic needle. Slow inoculation is essential to avoid cardiogenic shock in the rabbits.

3. Record the rectal temperatures of the inoculated rabbits twice daily.

4. On the third day after inoculation, anaesthetize the rabbits with a rapid intravenous injection of an overdose of reconstituted pentothal sodium.

5. Collect 10 ml of blood from each rabbit by cardiac puncture using a 20-ml syringe with an 18-gauge needle. Transfer the blood to a 30-ml screw-capped bottle containing 10 mg of EDTA and label with the rabbit number.

6. Kill the rabbit with a cervical blow, spread-eagle the carcass, swab the skin with PBSA and open the abdominal cavity.

7. Check the gut-associated lymphoid organs for the characteristic necrotic lesions, rejecting any rabbit that fails to score at least 3 out of 4 on an ascending four-point scale of severity.

8. Harvest the spleen and mesenteric lymph node of the selected rabbits, weigh the total harvest and add the non-coagulated blood from the selected rabbits.

9. Make up the volume of blood with PBSA to give a 20 percent tissue suspension and homogenize in a pre-cooled blender.

10. Measure the volume of the suspension and add 0.1 ml of the stock solutions of penicillin and streptomycin per 100 ml of tissue suspension.

11. Dispense 2 ml of the tissue suspension into small vials. These can be stored frozen at -70°C or lower, or freeze-dried and stored at -20°C.

Purified precipitated antigen. Attenuated rinderpest virus, strain RBOK, is grown in cultures of secondary calf kidney cells until cytopathic effects have spread through the cell sheet. The monolayer is then washed three times with warm PBS and the cells are scraped from the glass. The cells are now disrupted to release antigen by suspending them in a small volume of PBS and either sonicating for one to two minutes with a probe or freezing and thawing several times at -20°C.

An AGID test is set up using a 6-cm Petri dish filled with 5 ml of good-quality agar or agarose in which is cut a seven-well pattern of wells 5 mm in diameter with centres 9 mm apart. After filling the centre well with serum, the peripheral wells are filled with antigen and the reaction developed overnight at 4°C. The following day the plate is flooded with 0.85 percent saline and washed repeatedly for the next three to four days to remove non-specific protein from the agar. Then the rinderpest precipitate is excised and emulsified in Freund's complete adjuvant.

Methods

Multiple inoculations of non-lethal lapinized rinderpest virus

1. Either reconstitute the contents of a vial of freeze-dried suspension of the Japanese substrain of lapinized rinderpest virus with 20 ml cold PBSA or thaw out rapidly a frozen aliquot of the same substrain and dilute by adding 18 ml cold PBSA to give a final dilution of 1/50 (2 percent).

2. Inoculate intravenously 1 ml of the 2 percent infected tissue suspension very slowly into each of four rabbits. Record the rabbit rectal temperatures and examine the rabbits clinically twice daily to confirm that typical rinderpest reactions occur.

3. On day 7 post-inoculation (PI), inoculate each rabbit intraperitoneally with 1.0 ml of a freshly prepared 2 percent infected tissue suspension.

4. On day 11 PI, inoculate each rabbit intraperitoneally with 2 ml of a freshly prepared 2 percent suspension.

5. On day 15 PI, repeat the inoculations using a dose of 4 ml intraperitoneally.

6. On day 22 PI, shave the hairs of the skin over the marginal ear vein and along the caudal margin of the ear and then smear the shaved area with petroleum jelly. This procedure ensures clean collection of blood.

7. After an assistant has distended the marginal ear vein by nipping the caudal margin of the ear at its base between finger and thumb, make a shallow incision with a scalpel across and into the marginal ear vein. Allow the blood to drip into a suitable silicone-coated container until 5 ml have been collected. Stop the bleeding by transferring the finger and thumb pressure to the incision site using a pledget of cotton wool to hasten clot formation.

8. The collected blood is allowed to clot undisturbed. Once a firm clot has formed, it is freed from the walls of the container by a sharp tap and allowed to contract, releasing serum. Centrifuge gently and aspirate off the clean serum.

9. The antibody activity of the serum sample is assessed by testing serial dilutions in an appropriate system, for example AGID. If the potency is satisfactory, collect 30 ml of blood for serum either from the marginal ear vein or by cardiac puncture under general anaesthesia.

10. Further bleeding can be made every ten days.

11. If the potency of the serum declines, administer another intraperitoneal inoculation of the 2 percent infected tissue suspension and bleed for serum four days later.

12. Proven sera from several rabbits are pooled and dispensed into 1-ml aliquots that are either stored frozen at -20°C or, preferably, freeze-dried.

Multiple inoculations of lethal lapinized rinderpest virus

1. Protect the rabbits from the lethal effects of the Kabete substrain of lapinized rinderpest virus by pre-injecting them intravenously either with 1 ml of a suspension of avianized-lapinized rinderpest virus or anti-rinderpest rabbit serum at the rate of 2 ml per kilogram of body weight.

2. Rabbits protected actively by the inoculation of avianized-lapinized virus are boosted by a series of increasing doses of the lethal lapinized virus, beginning with 1 ml administered intraperitoneally one week later. The regimen of doses is thereafter similar to that of the non-lethal strain.

3. Rabbits protected passively by the administration of antiserum are challenged 24 hours later by the inoculation of 1 ml of the 2 percent suspension of tissues from rabbits infected with the Kabete substrain. The regimen of doses thereafter is as described above.

Virus-adjuvant mixtures. Virus-adjuvant combinations avoid the necessity of administering multiple doses at frequent intervals. If the virus strain used is the lethal Kabete substrain, the rabbits must first be protected, either actively or passively. If the virus strain is non-lethal or if a purified precipitated antigen is used, prior protection is not necessary. Both adjuvants give similar results.

1. Reconstitute freeze-dried virus or thaw an aliquot of frozen virus and dilute to give 2 percent suspensions in PBSA.

2. Mix equal volumes of adjuvant and virus suspension by adding the virus suspension slowly to the adjuvant while stirring constantly.

3. Inoculate the rabbits with the virus-adjuvant emulsion intramuscularly at several sites until a total of 2 ml is administered. Repeat one and two weeks later.

4. Test bleed the rabbits for serum one week after the last booster dose. If the serum potency is satisfactory, collect 30 ml of blood from each rabbit and thereafter bleed every ten days as long as the potency of the serum is maintained.

Appendix 2. Stock solutions

ADJUVANTS

Freund's complete adjuvant

Mineral oil	8.5 ml
Mannide mono-oleate (Arlacel A)	1.5 ml
Killed Mycobacterium phlei	25 mg

Homogenize. Store at 4°C.

Freund's incomplete adjuvant

As above, but without the killed mycobacteria.

ANTICOAGULANT

Ethylenediamine tetra-acetic acid dipotassium salt	1 g
Pure water	100 ml

Dispense 1.0 ml of the anticoagulant into each 12-ml tube and allow the water to evaporate at room temperature. This suffices for 10 ml of blood.

Heparin lithium salt (Sigma)

Add 0.2 ml of 0.75 percent solution in saline to a sterile blood collecting tube and evaporate at room temperature. This suffices for 10 ml of blood.

BUFFERS AND BUFFER SOLUTIONS

Borate buffer (pH 9.6)

Boric acid	9 g
Sodium hydroxide	2 g

Dissolve in pure water and make up to 1 litre.

Borate-succinate buffer (pH 7.5)

Solution A

Sodium tetraborate	19 g
Pure water	1 litre

Solution B

Succinic acid	5.9 g
Pure water	1 litre

Gradually add solution B to 100 ml of solution A until pH is 7.5, then add sodium chloride to 0.14 M and inactivated horse serum to 1 percent.

Carbonate buffer (pH 9.6)

Sodium carbonate	3.18 g
Sodium hydrogen carbonate	5.86 g
Sodium azide	0.02 g

Dissolve in pure water and make up to 1 litre.

Citrate-phosphate buffer (pH 6.0)

Citric acid	0.77 g
Disodium hydrogen orthophosphate	4.52 g

Dissolve in pure water and make up to 1 litre.

Phosphate buffer (pH 7.5)

Stock solution A

Sodium dihydrogen orthophosphate GPR

3.12 g

Dissolve in pure water and make up to 100 ml.

Stock solution B

Ethylenediamine tetra-acetic acid dipotassium salt	1.00 g
Disodium hydrogen orthophosphate (anhydrous)	2.84 g

Dissolve in pure water and make up to 100 ml. Prior to use, mix 16 ml of solution A and 84 ml of solution B, adjust the pH to 7.5 and dilute 1 /10 in pure water.

Phosphate-buffered saline (PBS), Dulbeccos formula (pH 7.3)

Solution A (PBSA)

Sodium chloride	8.00g
Potassium chloride	0.20 g
Sodium hydrogen orthophosphate	1.15 g
Potassium dihydrogen orthophosphate	0.20 g

Dissolve in pure water and make up to 800 ml.

Solution B

Magnesium chloride hexahydrate

0.10 g

Dissolve in pure water and make up to 100 ml.

Solution C

Calcium chloride dihydrate - 0.10 g
Dissolve in pure water and make up to 100 ml.
Autoclave each solution separately. When cooled, pour solution B into solution A stirring slowly and then add solution C, i.e. eight parts A, one part B, one part C.

Complete Dulbecco's solution is rarely used. For most purposes, the calcium- and magnesium-free solution A (PBSA) suffices.

Sodium-acetate buffer (pH 4.4)

Sodium acetate	2.62g
Pure water	800.00 ml
Glacial acetic acid	3.88 ml

Make up to 1 litre with pure water. Prepare weekly.

Veronal-acetate buffer (pH 8.6)

Sodium acetate trihydrate	6.50g
Barbitone sodium	8.87g
Barbitone	1.13 g
Thiomersal	10.50 g
Pure water	1 litre

Prepare weekly.

Veronal buffer saline (pH 7.2)

Sodium chloride	85.00 g
Diethyl-barbituric acid	5.75 g
Sodium barbiturate	2.00 g
Magnesium chloride hexahydrate	1.68 g
Calcium chloride	0.28 g

Dissolve the diethyl-barbituric acid in 500 ml hot pure water and then add the other reagents. Make up to 2 litres with pure water. Autoclave at 121°C for 15 minutes.

Prior to use, dilute 1/5 in pure water, check the pH and chloride concentration (0.85 percent).

Counterimmunoelectrophoresis stain

96 percent ethyl alcohol	45 ml
Glacial acetic acid	10 ml
Pure water	45 ml
Coomassie brilliant blue R-250	5 g

Dissolve the dye by heating the mixture to 60°C, cool and filter.

FORMOL SALINE

Add one part formalin (e.g. 40 percent formaldehyde solution) to nine parts phosphate-buffered saline (PBS). (Note: If possible only leave tissues in formol saline for three days, then change to PBS, since longer exposure to formalin may denature epitopes.)

HIGH-SUGAR, LOW-AMINO ACID SUPPLEMENTED (HSLS) CELL CULTURE MEDIUM

Solution A

Sodium chloride	7 000 mg
Potassium chloride	400 mg
Magnesium sulphate heptahydrate	200 mg
Sodium dihydrogen orthophosphate	130 mg
Ammonium chloride	50 mg
d-glucose (dextrose)	2 500 mg
Lactalbumin hydrolysate	5 000 mg
Yeast extract	100 mg
l-glutamine	100 mg
l-glutamic acid	300 mg
l-methionine	100 mg
l-arginine	150 mg
d-biotin	1 mg
Folic acid	1 mg

Dissolve in pure water and make up to 1 litre.

Solution B

Phenol red	10 mg
Sodium hydrogen carbonate	250 mg

Dissolve in pure water and make up to 1 litre.

Solution C

Calcium chloride 200 mg

Dissolve in pure water and make up to 1 litre.

Mix solutions A and B and then add solution C. Sterilize by membrane filtration, dispense into 400-ml bottles and store at 4°C. This cell culture medium is not available commercially.

LIVER POWDER

Washed, finely chopped calf liver is ground with acetone and filtered through coarse filter-paper. The deposit is washed several times with acetone, dried and mortared to give a fine powder that can be kept at room temperature.

MAYER'S GLYCEROL ALBUMEN

Fresh egg-white	50 ml
Glycerol	50 ml
Sodium salicylate	1 g

Mix and stir; filter through coarse filter-paper.

MOUNTANTS

Kirkpatrick and Lendrum's DPX mountant (RI = 1.52)

Distrene 80	10 g
Dibutyl phthalate	5 ml
Xylene	35 ml

Tris-buffered glycerol (pH 9.0)

Solution A

Tris (hydroxymethyl) methylamine	12.1 g
Pure water	800.0 ml

Add concentrated hydrochloric acid until pH =9.0. Make up to 1 litre with pure water.

Solution B

Solution A	50.0 ml
Glycerol	50.0 ml

PEROXIDASE SUBSTRATES

(a)

3,3' diaminobenzidine tetrahydrochloride	5.0 mg
Phosphate-buffered saline (Dulbecco A) (pH 6.3)	10.0 ml
Hydrogen peroxide (30 percent w/v)	5.0 m l

(b)

Ortho-phenylenediamine	3.4 mg
Citrate phosphate buffer (pH 6.0)	10.0 ml
Hydrogen peroxide (30 percent w/v)	4.0 m l

SATURATED AMMONIUM SULPHATE SOLUTION

Dissolve 1 kg of ammonium sulphate in 1 litre of pure water at 50°C. Allow the solution to stand overnight at room temperature and then adjust the pH to 7.2 with diluted ammonium hydroxide solution or sulphuric acid. (Note: pH meters are not accurate with high salt concentrations, therefore, use phenol red indicator of pH indicator papers.)

TRYPTOSE PHOSPHATE BROTH (TPB)

Difco bacto-tryptose	20.2 g
d-glucose (dextrose)	2.0 g
Sodium chloride	5.0 g
Disodium hydrogen orthophosphate	2.5 g

Dissolve in pure water and make up to 1 litre. Dispense into 100-ml bottles and autoclave at 121 °C for 15 minutes. Store at 4°C.

VERSENE-TRYPSIN (VT)

Sodium chloride	8 000 mg
Potassium chloride	400 mg
d-glucose (dextrose)	1 000 mg
Difco trypsin 1:250	100 mg
Ethylenediamine tetra-acetic acid	100 mg
Sodium hydrogen carbonate	550 mg

Dissolve in pure water and make up to 1 litre. Sterilize by membrane filtration, dispense into 100-ml bottles and store at 4°C. (Difco Laboratories Inc., Detroit, Michigan, United States.)

ZINC SULPHATE SOLUTION

Zinc sulphate	208 mg
Pure water boiled for 15 minutes to remove CO2	1 litre

Store in dispenser with a soda-lime tube.

ZINC SULPHATE TURBIDITY (ZST) STANDARD

Solution A

Barium chloride	1.15 g
Pure water	100 ml

Solution B

Solution A	3 ml
0.1 M sulphuric acid	97 ml

The turbidity of this solution is 20 ZST units.

Appendix 3. Fifty percent effective dose (ED50): Spearman-Kärber method

The ED₅₀ dose is that which is effective in 50 percent of the inoculated cell cultures, i.e. the median effective dose. When viruses or antibodies are assayed, serial dilutions are used. Serial twofold steps using ten cell culture tubes yield more accurate results than serial tenfold steps and five cell culture tubes per step, for example, titration of rinderpest virus vaccine in bovine kidney cells.

Dilution	Number of tubes	Number with cytopathic effect (CPE)	Proportion positive (P)
10-1	5	5	1.00
10-2	5	5	1.00 = Xk
10-3	5	4	0.80
10-4	5	2	0.40
10-5	5	1	0.20
10-6	5	0	0.00 = x1
10-7	5	0	0.00
Dose = 0.1 ml		S P=2.40

Where x₁ is the dose at P = 0.00, i.e. -6
and x^k is the smallest dose at P = 1.00, i.e. -2
S P=2.40 is the sum between x₁ and x_k, i.e. 2.40

d is the logarithm of the dilution factor, i.e. 10 = 1

Calculate m

= x_k - (d)(EP - 0.5)
= -2 - (1)(2.40 - 0.5) = -2 - (1)(1.9) = -3.9

Therefore the ED₅₀ dilution is 10^-39 per 0.1 ml

Appendix 4. Formulae for calculating Tm and oligonucleotide concentration

FORMULA FOR DETERMINATION OF PRIMER T_M

A rough method of determining the melting temperature of the annealed primer is the formula:

Tp = 22 + 1.46 (Ln) where
Tp = optimized annealing temperature ± 2.5°C
Ln = 2 (no. G+C) + (no. A+T)

i.e. for primer RPVF1 5' GGGACAGTGCTTCAGCCTATTAAGG

A (6); T (6); G (8); C (5), Ln = 2 (13) + 12 = 38
Tp = 22+1.46 (38) = 77.8°C

A simpler formula is:

4 (G+C) + 2 (A+T) = 4 (13) + 2 (12) = 76°C

DETERMINATION OF OLIGONUCLEOTIDE CONCENTRATION

Formula 1

OD₂₆₀ of 1.0 = 33 m g/ml oligonucleotides

An OD₂₆₀ of 0.25 for a 1/100 dilution of the primer would give a concentration of 0.25 × 100 × 33 = 825 m g/ml = 0.825 g/L = 825 ng/m l.

The molar concentration would then be given by:

= 101.5 m M = 101.5 pmol/m l

Mean MW of a base = 325 g/mol.

A more accurate concentration is given by the second formula.

Formula 2

= m M concentration

For the above primer this would be:

= 89.70 m M

Bibliography

Akita, G.Y., Glenn, J., Castro, A.E. & Osburn, B.I. 1993. Detection of bluetongue virus in clinical samples by polymerase chain reaction. J. Vet. Diagn. Invest., 5: 154-158.

Al-Ani, F.K. 1992. Haematologlogical, serum electrolytes, blood gases and acid-base values of calves with rinderpest. Iraqi J. Vet. Sci., 5: 187-196, [Abst. in Vet. Bull., 63: 764 (1993).]

Ali, B., El H. & Lees, G.E. 1979. The application of immunoelectroprecipitation in the diagnosis of rinderpest. Bull. Anim. Hlth Prod. Afr., 27: 1-6.

Anderson, J. 1984. Use of monoclonal antibody in a blocking ELISA to detect group specific antibodies to bluetongue virus. J. Imm. Meth. 74: 139-149.

Anderson, J. & McKay, J.A. 1994. The detection of antibodies against peste des petits ruminants virus in cattle, sheep and goats and the possible implications to rinderpest control programmes. Epidemiol. Infect., 112: 225-231.

Anderson, J. & Rowe, L.W. 1982. Application of enzyme immuno-assays in rinderpest research. In R.C. Wardley & J. R. Crowther, eds. The ELISA: enzyme-linked immunosorbent assay in veterinary research and diagnosis, p. 176-191 .The Hague, the Netherlands, Martinus Nijhoff.

Anderson, J., McKay, J.A. & Butcher, R.N. 1991. The use of monoclonal antibodies in competitive ELISA for the detection of antibodies to rinderpest and peste des petits ruminants viruses. In The sero-monitoring of rinderpest throughout Africa, Phase One. Proceedings of the Final Research Coordination Meeting of the IAEA Rinderpest Control Projects, Côte d'Ivoire, November 1990. IAEA publication TECDOC-623. Vienna, Austria, International Atomic Energy Agency (IAEA).

Anderson, J., Rowe, L.W., Taylor, W.P. & Crowther, J.R. 1982. An enzyme-linked immunosorbent assay for the detection of IgG, IgA and IgM antibodies to rinderpest virus in experimentally infected cattle. Res. Vet. Sci., 32: 242-247.

Barrett, T., Amarel-Doel, C., Kitching, R.P. & Gusev, A. 1993a. Use of the polymerase chain reaction in differentiating rinderpest field virus and vaccine virus in the same animals. Rev. Sci. Tech. Off. Int. Epiz., 12: 865-872.

Barrett, T., Visser, I.K.G., Mamaev, L., Goatley, L., Van Bressem, M.-F. & Osterhaus, A.D.M.E. 1993b. Dolphin and porpoise morbilliviruses are genetically distinct from phocine distemper virus. Virology, 193: 1010-1012.

Bergmann, I.E., Mello, P.A. de, Neitzert, E., Beck, E. & Gomes, I. 1993. Diagnosis of persistent aphthovirus infection and its differentiation from vaccination response in cattle by use of enzyme-linked immunoelectro-transfer blot analysis with bio-engineered non-structural viral antigen Am. J. Vet. Res., 54: 825-831.

Chamberlain, R.W., Wamwayi, H.M., Hockley, E., Shaila, M.S., Goatley, L., Knowles, NJ. & Barrett, T. 1993. Evidence for different lineages of rinderpest virus reflecting their geographic isolation. J. Gen. Virol., 74: 2775-2780.

Chomczyñski, P. & Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159.

Curasson, G. 1932. La peste bovine. Paris, Prance, Vigot.

Dardiri, A.H., Deboer, CJ. & Hamdy, F.M. 1977. Response of American goats and cattle to peste des petits ruminants virus. Proc. Ann. Mtg Am. Ass. Vet. Lab. Diagnosticians, Florida, 1977,19: 337-344.

Debnath, J.C. & Chottopadhyay, A.P. 1992. Effect of polyethelyene glycol concentration on the diagnosis of rinderpest antigen - a field study. Indian J. Anim. Hlth, 31: 75-77.

Diallo, A. 1990. Morbillivirus group: genome organization and proteins. Vet. Microbiol., 23: 155-163.

Diallo, A., Barrett, T., Barbron, M., Subbarao, S.M. & Taylor, W.P. 1989. Differentiation of rinderpest and peste des petits ruminants viruses using specific cDNA clones. J. Virol. Meth., 23: 127-136.

Duignan, PJ., Saliki, J.T., St Aubin, D.J., House, J.A. & Geraci, J.R. 1994. Neutralizing antibodies to phocine distemper virus in Atlantic walruses (Odobenus rosmarus rosmarus) from Arctic Canada. J. Wildl. Dis., 30: 90-94.

Edwards, J.T. 1928. Rinderpest: active immunization by means of the serum-simultaneous method; goat virus. Agric. J. India, 23:185-189.

Evermann, J.F., Berry, E.S., Baszler, T.V., Lewis, T.L., Byington, T.C. & Dilbeck, P.M. 1993. Diagnostic approaches for the detection of bovine viral diarrhoea (BVD) virus and related pestiviruses. J. Vet. Diagn. Invest., 5: 265-269.

Fenton, A., Nettleton, P.F., Entrican, G., Herring, J.A., Malloy, C. & Greig, A. 1991. Identification of cattle infected with bovine virus diarrhoea virus using a monoclonal antibody capture ELISA. Arch. Virol., Suppl. 3: 169-174.

Forsyth, M. & Barrett, T. 1995. Evaluation of the polymerase chain reaction for the detection and characterisation of rinderpest and peste des petits ruminants viruses for epidemiological studies. Virus Research.

French, M.H. 1936. The serum protein changes induced by rinderpest virus. J. Comp. Path. Ther., 49: 118-140.

Gathumbi, P.K. 1990. Immunohistological confirmation of a diagnosis of rinderpest from a recent natural outbreak. Bull. Anim. Hlth Prod. Afr., 38: 375-377.

Gibbs, E.P.J., Taylor, W.P., Lawman, M.J.P. & Bryant, J. 1979. Classification of peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology, 11:268-274.

Heuschele, W.P. & Barber, T.L. 1966. Changes in certain blood components of rinderpest-infected cattle. Am. J. Vet. Res., 27: 1001-1006.

Hudson, J.R. & Wongsongsarn, C. 1950. The utilisation of pigs for the production of lapinised rinderpest virus. Br. Vet. J., 106: 34-36.

Injairu, R.M. 1984. CIEP in the Field., University of Edinburgh, UK. (Dissertation).

Khera, K.S. 1958. Etude histologique de la peste bovine. I. Pathogenese du virus de la peste bovine dans les ganglions lymphatioques. Rev. Elev. Méd. Vét. Pays Trop., 11: 399-405.

Kobune, K., Sakata, H., Sugiyama, M. & Sugiura, A. 1991. B95a, a marmoset lymphoblastoid cell line, as a sensitive host for rinderpest virus. J. Gen. Virol., 72: 687-692.

Kolle, W. & Turner, G. 1897. Über den Fortgang der Rinderpestforschungen in Koch's Versuchestation in Kimberley. Mit spezieller Berücksichtigung einer Immunisierungs methode durch gleichzeitige Applikation von virulentem Infektionsstoff (Blut kranker Tiere) und Serum hochimmunisierter Tiere. Deutsche Med. Wochenschr., 23: 793-795.

Kovamees, J., Blixenkrone-Moller, M., Sharma, B., Orvell, C. & Norrby, E. 1991. The nucleotide sequence and deduced amino-acid composition of the haemagglutinin and fusion proteins of the morbillivirus phocid distemper virus. J. Gen. Virol., 72.:2959-2966.

Libeau, G., Diallo, A., Colas, F. & Guerre, L. 1994. Rapid differential diagnosis of rinderpest and PPR using an immuno-capture elisa. Vet. Record., 134 (12): 300.

Libeau, G. & Lefevre, P.C. 1990. Comparison of rinderpest and peste des petits ruminants viruses using anti-nucleoprotein monoclonal antibodies. Vet. Microbiol., 25: 1-16.

Maurer, F.D., Jones, T.C., Easterday, B. & Detray, D.E. 1956. The pathology of rinderpest. Proceedings of the 92nd Annual Meeting of the American Veterinary Medical Association, Minneapolis, MN, USA, 1955,p. 201-211. Chicago, IL, USA, American Veterinary Medical Association.

Obi, T.U. & McCullough, K.C. 1993. Identification of epitope expression on the internal proteins of rinderpest virus which is dependant upon virion maturation events. J. Virol. Meth., 41: 113-124.

Pandey, K.D., Baron, M.D. & Barrett, T. 1992. Differential diagnosis of rinderpest and PPR using biotinylated cDNA probes. Vet. Rec., 131: 199-200.

Plowright. W. & Ferris, R.D. 1961. Studies with rinderpest virus in tissue culture. III. The stability of cultured virus and its use in virus neutralization tests. Arch. Virol., 11: 516-533.

Reid, H.W., Buxton, D., Pow, I. & Finlayson, J. 1989. Isolation and characteristics of lymphoblastoid cells from cattle and deer affected with sheep-associated malignant catarrhal fever. Res. Vet. Sci., 47: 90-96.

Roeder, P. & Le Blanc Smith, P. 1987. Detection and typing of foot-and-mouth disease virus by enzyme-linked immunosorbent assay: a sensitive, rapid and reliable technique for diagnosis. Res. Vet. Sci., 43: 225-232.

Rossiter, P.B. 1984. Notes on immuno-precipitin reactions with rinderpest virus. Trop. Anim. Hlth Prod., 17: 55-56.

Rossiter, P.B. & Jessett, D.M. 1982. Detection of rinderpest virus antigens in vitro and in vivo by direct immunofluorescence. Res. Vet. Sci., 33: 198-204.

Rossiter, P.B. & Mushi, E.Z. 1980. Rapid detection of rinderpest virus antigen by counter-immuno-electrophoresis. Trop. Anim. Hlth Prod., 12: 209-216.

Rossiter, P.B., Herniman, K.A.J., Gumm, I.D. & Morrison, W.I. 1993. The growth of cell culture-attenuated rinderpest virus in bovine lymphoblasts with B cell, CD4+ and CD8+ alpha/beta T cell and gamma/delta T cell phenotypes. J. Gen. Virol. ,74: 305-309.

Rossiter, P.B., Herniman, A.J. & Wamwayi, H.M. 1992. Improved isolation of rinderpest virus in transformed bovine T lymphoblast cell lines. Res. Vet. Sci., 53: 11-18.

Rossiter, P.B., Wafula, J.S., Gumm, I.D., Stagg, D.A., Morzaria, S.P. & Shaw, M. 1988. Growth of rinderpest and BVD viruses in Theileria parva infected lympboblastoid cell lines. Vet .Rec., 122: 491-492.

Sahal, M. 1992. Kurzbericht: Bericht über die Rinderpest in der Turkei 1991/92. Deutsche Tierärztl. Wochenschr., 99: 349-350.

Scott, G.R. 1981. Rinderpest. In J.W. Davies, L.H. Karstad & D.D. Trainer, eds. Infectious diseases of wild mammals, 2nd ed. p. 18-30. Ames, IA, USA, Iowa State University Press.

Scott, G.R. & Brown, R.D. 1961. Rinderpest diagnosis with special reference to the agar gel double diffusion test. Bull. Epiz. Dis. Afr., 9: 83-120.

Selvakumar, R., Padmanaban, V.D., & Balaprakasam, R.A. 1981. Immunoproxidase technique in the diagnosis of rinderpest. Cherion, Madras, 10: 137-139.

Semmer, E. 1893. Rinderpest-infektion und Immunisierung und Schutzimpfung gegen Rinderpest. Berl. Tierärztl. Wochenschr., 23: 590-591.

Singh, S.N., Tanwani, S.K., Singh, R. & Kangude, C.M. 1972. Detection of rinderpest virus by an indirect haemagglutination test. Indian Vet J., 49: 355-359.

Thiery, G. 1956. Hématologie, histopathologie et histochimie de la peste bovine. Intérêt de l'étude histochimique des inclusions cellulaires de la peste bovine pour la signification générale des inclusions dans les maladies a virus. Rev. Elev. Méd. Vét. Pays Trop., 9: 117-140.

Wamwayi, H.M. 1989. Efficacy of some chemicals and disinfectants against rinderpest virus. Bull. Anim. Hlth Prod. Afr., 37:255-260.

Wamwayi, H.M., Rossiter, P.B. & Wafula, J.S. 1991. Confirmation of rinderpest in experimentally and naturally infected cattle using microtitre techniques. Trop. Anim. Hlth Prod., 73: 17-21.

White, G. 1958. A specific diffusible antigen of rinderpest virus demonstrated by the agar double-diffusion precipitation reaction. Nature, Lond., 181: 1409.

Wohlsein,P., Trautwein, G., Harder, T.C., Liess, B. & Barrett, T. 1993. Viral antigen distribution in organs of cattle experimentally infected with rinderpest virus. Vet. Pathol., 30: 544-554.

Youssef, H.M., Samy, A.M., El Bagoury, G.F. & Saber, M.S. 1991. Studies on prevalence of rinderpest (RP), bovine diarrhoea (BVD) and infectious bovine rhinotracheitis (IBR) antibodies in Egyptian swine sera. Vet. Med. J. Giza, 39: 47-56.

Zaghara, A., Liess, B. & Frey, H.R. 1990. Antiserum raised in pigs against canine distemper virus and its utility in diagnostic procedures for morbillivirus infections (canine distemper, phocine distemper, rinderpest). J. Vet. Med. B, 37: 353-362.

RECOMMENDED PCR TEXTBOOKS

Innis, M.A., Gelfand, D.H., Sninsky, JJ. & White, T.J. 1990. PCR protocols: a guide to methods and applications. London, UK, Academic Press Inc.

Mc Pherson, M.J., Quirke, P. & Taylor, G.R. 1993. PCR: a practical approach. Blackwells, The Practical Approach Series.

Rolfs, A., Schuller, I., Finckh, U., Weber-Rolfs, I. 1992. PCR: clinical diagnostics and research. Berlin, Germany, Springer-Verlag.

Rinderpest (or cattle plague) is a contagious viral disease of cloven-hoofed animals, particularly cattle and buffaloes. It is one of the most deadly extant animal diseases, having caused tremendous losses in cattle populations throughout the world during the last 100 years. The morbidity rate can approach 100 percent among susceptible non-vaccinated cattle and buffaloes, and in newly infected regions mortality may exceed 90 percent. After many years of relative freedom from the scourge of rinderpest, cattle stocks in Africa since 1979 have been facing serious depletion because of an alarming resurgence of the disease. This manual, supplemented by many useful illustrations, describes clearly and concisely the proven techniques in the diagnosis of rinderpest. Part I deals with presumptive diagnosis in the field; Part II provides guidelines for the collection and transport of specimens for diagnosis; and Part III treats confirmatory diagnostic methods - antigen detection, antibody detection, virus isolation and identification, histopathology and differential diagnosis. The manual will be of assistance to both field and laboratory personnel, to those Involved In the large-scale international campaigns against rinderpest now under way in Africa, South Asia and the Near East, and also to those countries trying to improve their diagnostic capabilities In order to prevent catastrophic outbreaks of the disease arising from the movement of livestock and livestock products.